Incidental Mutation 'R9049:Tnks'
ID 688244
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34841778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1109 (K1109R)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: K1109R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: K1109R

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect probably benign
Transcript: ENSMUST00000210014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,038 Y323C probably benign Het
3110009E18Rik A G 1: 120,188,170 I118V probably null Het
3110043O21Rik A G 4: 35,192,964 I455T unknown Het
Abcc9 A G 6: 142,682,932 L362P probably damaging Het
Adam7 C A 14: 68,525,225 V184F probably benign Het
Adgre4 T C 17: 55,785,094 I118T probably benign Het
Akap9 T C 5: 4,064,597 L3292P Het
Akr1b10 A G 6: 34,396,626 E308G possibly damaging Het
Ash1l T C 3: 89,007,364 V1767A probably benign Het
Bpifb3 C A 2: 153,925,890 N294K probably benign Het
Bpifb5 A G 2: 154,228,176 N182S probably benign Het
Camkmt A G 17: 85,402,484 I205M possibly damaging Het
Ccdc88b C T 19: 6,849,074 R1091Q probably benign Het
Cfap58 A T 19: 48,026,718 probably null Het
Clca1 T A 3: 145,027,382 I122L probably benign Het
Col6a3 T A 1: 90,779,344 S2623C unknown Het
Cpne5 A G 17: 29,160,358 S484P probably damaging Het
Cyp4f39 T A 17: 32,486,991 L352Q probably damaging Het
Dcun1d1 T C 3: 35,897,849 N183D probably benign Het
Dgkg A G 16: 22,600,588 V54A probably benign Het
Dnah12 T A 14: 26,722,120 D561E probably benign Het
Dnah6 A C 6: 73,142,292 L1536R probably damaging Het
Gm15448 T A 7: 3,816,891 T676S unknown Het
Gm21834 G A 17: 57,741,831 T130I possibly damaging Het
Hectd4 T A 5: 121,313,892 V434E possibly damaging Het
Htr3a C A 9: 48,899,787 V459L probably damaging Het
Mdfi C A 17: 47,824,554 V84L probably damaging Het
Mdm1 C T 10: 118,146,700 T80M probably benign Het
Muc5ac A C 7: 141,808,975 I2008L unknown Het
Nomo1 A G 7: 46,066,173 D681G probably benign Het
Olfr1030 A G 2: 85,983,891 E17G possibly damaging Het
Olfr127 G A 17: 37,903,873 W109* probably null Het
Olfr193 T G 16: 59,110,400 D70A probably damaging Het
Olfr366 C G 2: 37,219,947 H153D probably damaging Het
Olfr406 A G 11: 74,270,289 K300R possibly damaging Het
Olfr860 T C 9: 19,845,749 Y290C probably damaging Het
Olfr979 G T 9: 40,000,623 N201K possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pld3 C T 7: 27,535,868 V312M possibly damaging Het
Pnisr T A 4: 21,854,391 W12R unknown Het
Polr3e A G 7: 120,939,239 K410R probably benign Het
Ppif G T 14: 25,694,412 V61L possibly damaging Het
Pramel5 T C 4: 144,273,916 N30S probably benign Het
Prex2 T G 1: 11,185,906 L1167R probably damaging Het
Prl3a1 T A 13: 27,276,184 L217H probably damaging Het
Prop1 G C 11: 50,952,121 Q80E probably damaging Het
Psma1 T C 7: 114,266,529 I214V probably benign Het
Ptgfr T A 3: 151,835,767 I35F probably benign Het
Rcvrn A T 11: 67,695,742 Y109F probably benign Het
Repin1 A G 6: 48,597,712 D525G possibly damaging Het
Slc12a2 A T 18: 57,921,791 R835* probably null Het
Sqle T C 15: 59,317,862 F118L probably benign Het
Stard9 A T 2: 120,679,937 Y333F probably benign Het
Tbc1d16 G A 11: 119,209,264 R95C probably damaging Het
Tln1 C A 4: 43,549,786 E542* probably null Het
Tmem161b G T 13: 84,294,635 A407S probably benign Het
Tnc G T 4: 64,000,010 D1221E possibly damaging Het
Tpp2 T C 1: 43,953,342 V194A possibly damaging Het
Ust G A 10: 8,307,454 Q162* probably null Het
Utp15 T C 13: 98,259,270 Y68C probably damaging Het
Vcan A T 13: 89,678,105 H3193Q probably damaging Het
Vmn2r55 T C 7: 12,684,981 Y4C probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8870:Tnks UTSW 8 34847279 critical splice donor site probably null
R8936:Tnks UTSW 8 34853347 nonsense probably null
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGTCACATTTAAAGGCTGGC -3'
(R):5'- TGCCTTTGGTATATCTGCTTACAG -3'

Sequencing Primer
(F):5'- CACATTTAAAGGCTGGCTGCTG -3'
(R):5'- AAATAGTGTAGATTGCTCTGAGCTG -3'
Posted On 2021-11-19