Incidental Mutation 'R9049:Tnks'
ID 688244
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, TANK1, tankyrase 1, 4930554K12Rik, D130072O21Rik
MMRRC Submission 068875-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 35296333-35432844 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35308932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1109 (K1109R)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: K1109R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: K1109R

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect probably benign
Transcript: ENSMUST00000210014
Meta Mutation Damage Score 0.3780 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,115,900 (GRCm39) I118V probably null Het
Abcc9 A G 6: 142,628,658 (GRCm39) L362P probably damaging Het
Adam7 C A 14: 68,762,674 (GRCm39) V184F probably benign Het
Adgre4 T C 17: 56,092,094 (GRCm39) I118T probably benign Het
Akap9 T C 5: 4,114,597 (GRCm39) L3292P Het
Akr1b10 A G 6: 34,373,561 (GRCm39) E308G possibly damaging Het
Aopep A G 13: 63,208,852 (GRCm39) Y323C probably benign Het
Ash1l T C 3: 88,914,671 (GRCm39) V1767A probably benign Het
Bpifb3 C A 2: 153,767,810 (GRCm39) N294K probably benign Het
Bpifb5 A G 2: 154,070,096 (GRCm39) N182S probably benign Het
C9orf72 A G 4: 35,192,964 (GRCm39) I455T unknown Het
Camkmt A G 17: 85,709,912 (GRCm39) I205M possibly damaging Het
Ccdc88b C T 19: 6,826,442 (GRCm39) R1091Q probably benign Het
Cfap58 A T 19: 48,015,157 (GRCm39) probably null Het
Clca3a1 T A 3: 144,733,143 (GRCm39) I122L probably benign Het
Col6a3 T A 1: 90,707,066 (GRCm39) S2623C unknown Het
Cpne5 A G 17: 29,379,332 (GRCm39) S484P probably damaging Het
Cyp4f39 T A 17: 32,705,965 (GRCm39) L352Q probably damaging Het
Dcun1d1 T C 3: 35,951,998 (GRCm39) N183D probably benign Het
Dgkg A G 16: 22,419,338 (GRCm39) V54A probably benign Het
Dnah12 T A 14: 26,443,275 (GRCm39) D561E probably benign Het
Dnah6 A C 6: 73,119,275 (GRCm39) L1536R probably damaging Het
Gm21834 G A 17: 58,048,826 (GRCm39) T130I possibly damaging Het
Hectd4 T A 5: 121,451,955 (GRCm39) V434E possibly damaging Het
Htr3a C A 9: 48,811,087 (GRCm39) V459L probably damaging Het
Lonp2 T C 8: 87,435,735 (GRCm39) V657A probably benign Het
Mdfi C A 17: 48,135,479 (GRCm39) V84L probably damaging Het
Mdm1 C T 10: 117,982,605 (GRCm39) T80M probably benign Het
Muc5ac A C 7: 141,362,712 (GRCm39) I2008L unknown Het
Nomo1 A G 7: 45,715,597 (GRCm39) D681G probably benign Het
Or10g9 G T 9: 39,911,919 (GRCm39) N201K possibly damaging Het
Or14j6 G A 17: 38,214,764 (GRCm39) W109* probably null Het
Or1af1 C G 2: 37,109,959 (GRCm39) H153D probably damaging Het
Or1p1c A G 11: 74,161,115 (GRCm39) K300R possibly damaging Het
Or5h25 T G 16: 58,930,763 (GRCm39) D70A probably damaging Het
Or5m5 A G 2: 85,814,235 (GRCm39) E17G possibly damaging Het
Or7e169 T C 9: 19,757,045 (GRCm39) Y290C probably damaging Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pipox A G 11: 77,772,380 (GRCm39) I330T probably damaging Het
Pira13 T A 7: 3,819,890 (GRCm39) T676S unknown Het
Pld3 C T 7: 27,235,293 (GRCm39) V312M possibly damaging Het
Pnisr T A 4: 21,854,391 (GRCm39) W12R unknown Het
Polr3e A G 7: 120,538,462 (GRCm39) K410R probably benign Het
Ppif G T 14: 25,694,836 (GRCm39) V61L possibly damaging Het
Pramel5 T C 4: 144,000,486 (GRCm39) N30S probably benign Het
Prex2 T G 1: 11,256,130 (GRCm39) L1167R probably damaging Het
Prkacb A T 3: 146,461,518 (GRCm39) probably benign Het
Prl3a1 T A 13: 27,460,167 (GRCm39) L217H probably damaging Het
Prop1 G C 11: 50,842,948 (GRCm39) Q80E probably damaging Het
Psma1 T C 7: 113,865,764 (GRCm39) I214V probably benign Het
Ptgfr T A 3: 151,541,404 (GRCm39) I35F probably benign Het
Rcvrn A T 11: 67,586,568 (GRCm39) Y109F probably benign Het
Repin1 A G 6: 48,574,646 (GRCm39) D525G possibly damaging Het
Slc12a2 A T 18: 58,054,863 (GRCm39) R835* probably null Het
Sqle T C 15: 59,189,711 (GRCm39) F118L probably benign Het
Stard9 A T 2: 120,510,418 (GRCm39) Y333F probably benign Het
Tbc1d16 G A 11: 119,100,090 (GRCm39) R95C probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Tmem161b G T 13: 84,442,754 (GRCm39) A407S probably benign Het
Tnc G T 4: 63,918,247 (GRCm39) D1221E possibly damaging Het
Tpp2 T C 1: 43,992,502 (GRCm39) V194A possibly damaging Het
Ust G A 10: 8,183,218 (GRCm39) Q162* probably null Het
Utp15 T C 13: 98,395,778 (GRCm39) Y68C probably damaging Het
Vcan A T 13: 89,826,224 (GRCm39) H3193Q probably damaging Het
Vmn2r55 T C 7: 12,418,908 (GRCm39) Y4C probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 35,328,843 (GRCm39) splice site probably benign
IGL00901:Tnks APN 8 35,305,549 (GRCm39) nonsense probably null
IGL01448:Tnks APN 8 35,307,136 (GRCm39) missense probably damaging 1.00
IGL01455:Tnks APN 8 35,408,054 (GRCm39) missense probably damaging 0.99
IGL01962:Tnks APN 8 35,336,678 (GRCm39) missense probably damaging 1.00
IGL02088:Tnks APN 8 35,307,148 (GRCm39) missense possibly damaging 0.50
IGL02260:Tnks APN 8 35,310,137 (GRCm39) missense probably damaging 0.99
IGL02454:Tnks APN 8 35,298,882 (GRCm39) unclassified probably benign
IGL02486:Tnks APN 8 35,318,352 (GRCm39) missense probably damaging 1.00
IGL02612:Tnks APN 8 35,316,453 (GRCm39) missense possibly damaging 0.48
IGL03179:Tnks APN 8 35,315,824 (GRCm39) missense probably benign 0.38
IGL03404:Tnks APN 8 35,407,858 (GRCm39) missense probably damaging 1.00
R0256:Tnks UTSW 8 35,328,701 (GRCm39) missense probably benign 0.07
R0265:Tnks UTSW 8 35,307,124 (GRCm39) nonsense probably null
R0334:Tnks UTSW 8 35,320,413 (GRCm39) nonsense probably null
R0414:Tnks UTSW 8 35,320,463 (GRCm39) missense probably damaging 1.00
R0526:Tnks UTSW 8 35,320,457 (GRCm39) missense probably benign 0.23
R0622:Tnks UTSW 8 35,407,976 (GRCm39) missense probably damaging 1.00
R1445:Tnks UTSW 8 35,301,757 (GRCm39) splice site probably benign
R1618:Tnks UTSW 8 35,342,430 (GRCm39) missense probably damaging 1.00
R1779:Tnks UTSW 8 35,324,672 (GRCm39) missense probably benign 0.18
R1919:Tnks UTSW 8 35,342,386 (GRCm39) missense probably damaging 1.00
R1938:Tnks UTSW 8 35,305,684 (GRCm39) missense probably damaging 1.00
R2018:Tnks UTSW 8 35,318,260 (GRCm39) missense probably damaging 1.00
R2198:Tnks UTSW 8 35,340,221 (GRCm39) missense probably benign 0.29
R2198:Tnks UTSW 8 35,315,803 (GRCm39) missense probably benign
R2925:Tnks UTSW 8 35,432,815 (GRCm39) missense unknown
R3828:Tnks UTSW 8 35,340,332 (GRCm39) missense probably damaging 1.00
R3913:Tnks UTSW 8 35,340,228 (GRCm39) missense probably damaging 0.99
R3916:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3917:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3930:Tnks UTSW 8 35,407,966 (GRCm39) missense probably damaging 1.00
R4659:Tnks UTSW 8 35,316,465 (GRCm39) missense possibly damaging 0.53
R4760:Tnks UTSW 8 35,318,937 (GRCm39) missense probably benign 0.38
R5091:Tnks UTSW 8 35,308,963 (GRCm39) missense probably benign 0.40
R5419:Tnks UTSW 8 35,432,720 (GRCm39) missense unknown
R5558:Tnks UTSW 8 35,432,819 (GRCm39) start codon destroyed probably null
R5582:Tnks UTSW 8 35,408,015 (GRCm39) missense probably benign 0.14
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6495:Tnks UTSW 8 35,307,120 (GRCm39) critical splice donor site probably null
R6527:Tnks UTSW 8 35,340,247 (GRCm39) missense probably benign 0.36
R6991:Tnks UTSW 8 35,301,647 (GRCm39) missense probably damaging 1.00
R7015:Tnks UTSW 8 35,305,701 (GRCm39) missense probably benign 0.04
R7038:Tnks UTSW 8 35,318,790 (GRCm39) missense probably damaging 0.99
R7057:Tnks UTSW 8 35,307,168 (GRCm39) missense probably damaging 1.00
R7167:Tnks UTSW 8 35,316,458 (GRCm39) missense probably damaging 0.98
R7250:Tnks UTSW 8 35,318,912 (GRCm39) missense probably damaging 0.98
R7475:Tnks UTSW 8 35,298,866 (GRCm39) missense probably damaging 1.00
R7790:Tnks UTSW 8 35,328,694 (GRCm39) missense probably benign 0.01
R7818:Tnks UTSW 8 35,340,182 (GRCm39) missense probably benign 0.03
R7909:Tnks UTSW 8 35,407,858 (GRCm39) missense probably damaging 1.00
R7970:Tnks UTSW 8 35,323,080 (GRCm39) critical splice donor site probably null
R8341:Tnks UTSW 8 35,340,199 (GRCm39) missense probably damaging 1.00
R8343:Tnks UTSW 8 35,301,738 (GRCm39) missense probably benign 0.03
R8870:Tnks UTSW 8 35,314,433 (GRCm39) critical splice donor site probably null
R8936:Tnks UTSW 8 35,320,501 (GRCm39) nonsense probably null
R9080:Tnks UTSW 8 35,432,466 (GRCm39) small deletion probably benign
R9182:Tnks UTSW 8 35,308,905 (GRCm39) critical splice donor site probably null
R9211:Tnks UTSW 8 35,316,489 (GRCm39) missense probably damaging 1.00
R9425:Tnks UTSW 8 35,340,819 (GRCm39) missense probably damaging 1.00
R9649:Tnks UTSW 8 35,306,089 (GRCm39) missense probably damaging 0.96
Z1177:Tnks UTSW 8 35,432,299 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGTCACATTTAAAGGCTGGC -3'
(R):5'- TGCCTTTGGTATATCTGCTTACAG -3'

Sequencing Primer
(F):5'- CACATTTAAAGGCTGGCTGCTG -3'
(R):5'- AAATAGTGTAGATTGCTCTGAGCTG -3'
Posted On 2021-11-19