Incidental Mutation 'R9049:Ust'
ID 688248
Institutional Source Beutler Lab
Gene Symbol Ust
Ensembl Gene ENSMUSG00000047712
Gene Name uronyl-2-sulfotransferase
Synonyms UA2OST, D930010O20Rik
MMRRC Submission 068875-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.444) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 8080520-8394589 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 8183218 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 162 (Q162*)
Ref Sequence ENSEMBL: ENSMUSP00000052017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061601]
AlphaFold Q8BUB6
Predicted Effect probably null
Transcript: ENSMUST00000061601
AA Change: Q162*
SMART Domains Protein: ENSMUSP00000052017
Gene: ENSMUSG00000047712
AA Change: Q162*

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 53 317 8.5e-11 PFAM
Pfam:Sulfotransfer_2 98 359 6.4e-38 PFAM
low complexity region 385 398 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,115,900 (GRCm39) I118V probably null Het
Abcc9 A G 6: 142,628,658 (GRCm39) L362P probably damaging Het
Adam7 C A 14: 68,762,674 (GRCm39) V184F probably benign Het
Adgre4 T C 17: 56,092,094 (GRCm39) I118T probably benign Het
Akap9 T C 5: 4,114,597 (GRCm39) L3292P Het
Akr1b10 A G 6: 34,373,561 (GRCm39) E308G possibly damaging Het
Aopep A G 13: 63,208,852 (GRCm39) Y323C probably benign Het
Ash1l T C 3: 88,914,671 (GRCm39) V1767A probably benign Het
Bpifb3 C A 2: 153,767,810 (GRCm39) N294K probably benign Het
Bpifb5 A G 2: 154,070,096 (GRCm39) N182S probably benign Het
C9orf72 A G 4: 35,192,964 (GRCm39) I455T unknown Het
Camkmt A G 17: 85,709,912 (GRCm39) I205M possibly damaging Het
Ccdc88b C T 19: 6,826,442 (GRCm39) R1091Q probably benign Het
Cfap58 A T 19: 48,015,157 (GRCm39) probably null Het
Clca3a1 T A 3: 144,733,143 (GRCm39) I122L probably benign Het
Col6a3 T A 1: 90,707,066 (GRCm39) S2623C unknown Het
Cpne5 A G 17: 29,379,332 (GRCm39) S484P probably damaging Het
Cyp4f39 T A 17: 32,705,965 (GRCm39) L352Q probably damaging Het
Dcun1d1 T C 3: 35,951,998 (GRCm39) N183D probably benign Het
Dgkg A G 16: 22,419,338 (GRCm39) V54A probably benign Het
Dnah12 T A 14: 26,443,275 (GRCm39) D561E probably benign Het
Dnah6 A C 6: 73,119,275 (GRCm39) L1536R probably damaging Het
Gm21834 G A 17: 58,048,826 (GRCm39) T130I possibly damaging Het
Hectd4 T A 5: 121,451,955 (GRCm39) V434E possibly damaging Het
Htr3a C A 9: 48,811,087 (GRCm39) V459L probably damaging Het
Lonp2 T C 8: 87,435,735 (GRCm39) V657A probably benign Het
Mdfi C A 17: 48,135,479 (GRCm39) V84L probably damaging Het
Mdm1 C T 10: 117,982,605 (GRCm39) T80M probably benign Het
Muc5ac A C 7: 141,362,712 (GRCm39) I2008L unknown Het
Nomo1 A G 7: 45,715,597 (GRCm39) D681G probably benign Het
Or10g9 G T 9: 39,911,919 (GRCm39) N201K possibly damaging Het
Or14j6 G A 17: 38,214,764 (GRCm39) W109* probably null Het
Or1af1 C G 2: 37,109,959 (GRCm39) H153D probably damaging Het
Or1p1c A G 11: 74,161,115 (GRCm39) K300R possibly damaging Het
Or5h25 T G 16: 58,930,763 (GRCm39) D70A probably damaging Het
Or5m5 A G 2: 85,814,235 (GRCm39) E17G possibly damaging Het
Or7e169 T C 9: 19,757,045 (GRCm39) Y290C probably damaging Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pipox A G 11: 77,772,380 (GRCm39) I330T probably damaging Het
Pira13 T A 7: 3,819,890 (GRCm39) T676S unknown Het
Pld3 C T 7: 27,235,293 (GRCm39) V312M possibly damaging Het
Pnisr T A 4: 21,854,391 (GRCm39) W12R unknown Het
Polr3e A G 7: 120,538,462 (GRCm39) K410R probably benign Het
Ppif G T 14: 25,694,836 (GRCm39) V61L possibly damaging Het
Pramel5 T C 4: 144,000,486 (GRCm39) N30S probably benign Het
Prex2 T G 1: 11,256,130 (GRCm39) L1167R probably damaging Het
Prkacb A T 3: 146,461,518 (GRCm39) probably benign Het
Prl3a1 T A 13: 27,460,167 (GRCm39) L217H probably damaging Het
Prop1 G C 11: 50,842,948 (GRCm39) Q80E probably damaging Het
Psma1 T C 7: 113,865,764 (GRCm39) I214V probably benign Het
Ptgfr T A 3: 151,541,404 (GRCm39) I35F probably benign Het
Rcvrn A T 11: 67,586,568 (GRCm39) Y109F probably benign Het
Repin1 A G 6: 48,574,646 (GRCm39) D525G possibly damaging Het
Slc12a2 A T 18: 58,054,863 (GRCm39) R835* probably null Het
Sqle T C 15: 59,189,711 (GRCm39) F118L probably benign Het
Stard9 A T 2: 120,510,418 (GRCm39) Y333F probably benign Het
Tbc1d16 G A 11: 119,100,090 (GRCm39) R95C probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Tmem161b G T 13: 84,442,754 (GRCm39) A407S probably benign Het
Tnc G T 4: 63,918,247 (GRCm39) D1221E possibly damaging Het
Tnks T C 8: 35,308,932 (GRCm39) K1109R probably damaging Het
Tpp2 T C 1: 43,992,502 (GRCm39) V194A possibly damaging Het
Utp15 T C 13: 98,395,778 (GRCm39) Y68C probably damaging Het
Vcan A T 13: 89,826,224 (GRCm39) H3193Q probably damaging Het
Vmn2r55 T C 7: 12,418,908 (GRCm39) Y4C probably damaging Het
Other mutations in Ust
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Ust APN 10 8,173,842 (GRCm39) missense probably benign 0.09
IGL03056:Ust APN 10 8,083,326 (GRCm39) missense probably benign 0.01
R0015:Ust UTSW 10 8,205,829 (GRCm39) splice site probably benign
R0417:Ust UTSW 10 8,121,700 (GRCm39) missense probably damaging 1.00
R0423:Ust UTSW 10 8,173,912 (GRCm39) missense probably damaging 1.00
R0533:Ust UTSW 10 8,123,844 (GRCm39) splice site probably benign
R1344:Ust UTSW 10 8,173,954 (GRCm39) missense possibly damaging 0.82
R1436:Ust UTSW 10 8,183,202 (GRCm39) missense probably damaging 1.00
R1803:Ust UTSW 10 8,173,819 (GRCm39) critical splice donor site probably null
R2059:Ust UTSW 10 8,083,330 (GRCm39) missense probably damaging 1.00
R4248:Ust UTSW 10 8,393,982 (GRCm39) missense possibly damaging 0.67
R4811:Ust UTSW 10 8,121,705 (GRCm39) missense probably damaging 0.97
R5075:Ust UTSW 10 8,393,988 (GRCm39) missense probably damaging 0.97
R5912:Ust UTSW 10 8,173,825 (GRCm39) missense probably benign 0.25
R5950:Ust UTSW 10 8,123,865 (GRCm39) missense probably benign 0.33
R7302:Ust UTSW 10 8,393,973 (GRCm39) missense probably damaging 0.99
R7478:Ust UTSW 10 8,266,650 (GRCm39) critical splice donor site probably null
R7685:Ust UTSW 10 8,083,339 (GRCm39) missense probably damaging 1.00
R7704:Ust UTSW 10 8,205,987 (GRCm39) missense probably benign 0.02
R9425:Ust UTSW 10 8,205,873 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAATGAATGTCTCAAACTTTGGTC -3'
(R):5'- GCCCTTTGCAACAAGCTCAG -3'

Sequencing Primer
(F):5'- CTCTGTGTTGCAAAGCTAGC -3'
(R):5'- TGCAACAAGCTCAGCTGTCTG -3'
Posted On 2021-11-19