Incidental Mutation 'R9049:Dnah12'
ID 688261
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission 068875-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R9049 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26443275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 561 (D561E)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: D561E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: D561E

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,115,900 (GRCm39) I118V probably null Het
Abcc9 A G 6: 142,628,658 (GRCm39) L362P probably damaging Het
Adam7 C A 14: 68,762,674 (GRCm39) V184F probably benign Het
Adgre4 T C 17: 56,092,094 (GRCm39) I118T probably benign Het
Akap9 T C 5: 4,114,597 (GRCm39) L3292P Het
Akr1b10 A G 6: 34,373,561 (GRCm39) E308G possibly damaging Het
Aopep A G 13: 63,208,852 (GRCm39) Y323C probably benign Het
Ash1l T C 3: 88,914,671 (GRCm39) V1767A probably benign Het
Bpifb3 C A 2: 153,767,810 (GRCm39) N294K probably benign Het
Bpifb5 A G 2: 154,070,096 (GRCm39) N182S probably benign Het
C9orf72 A G 4: 35,192,964 (GRCm39) I455T unknown Het
Camkmt A G 17: 85,709,912 (GRCm39) I205M possibly damaging Het
Ccdc88b C T 19: 6,826,442 (GRCm39) R1091Q probably benign Het
Cfap58 A T 19: 48,015,157 (GRCm39) probably null Het
Clca3a1 T A 3: 144,733,143 (GRCm39) I122L probably benign Het
Col6a3 T A 1: 90,707,066 (GRCm39) S2623C unknown Het
Cpne5 A G 17: 29,379,332 (GRCm39) S484P probably damaging Het
Cyp4f39 T A 17: 32,705,965 (GRCm39) L352Q probably damaging Het
Dcun1d1 T C 3: 35,951,998 (GRCm39) N183D probably benign Het
Dgkg A G 16: 22,419,338 (GRCm39) V54A probably benign Het
Dnah6 A C 6: 73,119,275 (GRCm39) L1536R probably damaging Het
Gm21834 G A 17: 58,048,826 (GRCm39) T130I possibly damaging Het
Hectd4 T A 5: 121,451,955 (GRCm39) V434E possibly damaging Het
Htr3a C A 9: 48,811,087 (GRCm39) V459L probably damaging Het
Lonp2 T C 8: 87,435,735 (GRCm39) V657A probably benign Het
Mdfi C A 17: 48,135,479 (GRCm39) V84L probably damaging Het
Mdm1 C T 10: 117,982,605 (GRCm39) T80M probably benign Het
Muc5ac A C 7: 141,362,712 (GRCm39) I2008L unknown Het
Nomo1 A G 7: 45,715,597 (GRCm39) D681G probably benign Het
Or10g9 G T 9: 39,911,919 (GRCm39) N201K possibly damaging Het
Or14j6 G A 17: 38,214,764 (GRCm39) W109* probably null Het
Or1af1 C G 2: 37,109,959 (GRCm39) H153D probably damaging Het
Or1p1c A G 11: 74,161,115 (GRCm39) K300R possibly damaging Het
Or5h25 T G 16: 58,930,763 (GRCm39) D70A probably damaging Het
Or5m5 A G 2: 85,814,235 (GRCm39) E17G possibly damaging Het
Or7e169 T C 9: 19,757,045 (GRCm39) Y290C probably damaging Het
Pip5k1c C A 10: 81,152,710 (GRCm39) probably benign Het
Pipox A G 11: 77,772,380 (GRCm39) I330T probably damaging Het
Pira13 T A 7: 3,819,890 (GRCm39) T676S unknown Het
Pld3 C T 7: 27,235,293 (GRCm39) V312M possibly damaging Het
Pnisr T A 4: 21,854,391 (GRCm39) W12R unknown Het
Polr3e A G 7: 120,538,462 (GRCm39) K410R probably benign Het
Ppif G T 14: 25,694,836 (GRCm39) V61L possibly damaging Het
Pramel5 T C 4: 144,000,486 (GRCm39) N30S probably benign Het
Prex2 T G 1: 11,256,130 (GRCm39) L1167R probably damaging Het
Prkacb A T 3: 146,461,518 (GRCm39) probably benign Het
Prl3a1 T A 13: 27,460,167 (GRCm39) L217H probably damaging Het
Prop1 G C 11: 50,842,948 (GRCm39) Q80E probably damaging Het
Psma1 T C 7: 113,865,764 (GRCm39) I214V probably benign Het
Ptgfr T A 3: 151,541,404 (GRCm39) I35F probably benign Het
Rcvrn A T 11: 67,586,568 (GRCm39) Y109F probably benign Het
Repin1 A G 6: 48,574,646 (GRCm39) D525G possibly damaging Het
Slc12a2 A T 18: 58,054,863 (GRCm39) R835* probably null Het
Sqle T C 15: 59,189,711 (GRCm39) F118L probably benign Het
Stard9 A T 2: 120,510,418 (GRCm39) Y333F probably benign Het
Tbc1d16 G A 11: 119,100,090 (GRCm39) R95C probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Tmem161b G T 13: 84,442,754 (GRCm39) A407S probably benign Het
Tnc G T 4: 63,918,247 (GRCm39) D1221E possibly damaging Het
Tnks T C 8: 35,308,932 (GRCm39) K1109R probably damaging Het
Tpp2 T C 1: 43,992,502 (GRCm39) V194A possibly damaging Het
Ust G A 10: 8,183,218 (GRCm39) Q162* probably null Het
Utp15 T C 13: 98,395,778 (GRCm39) Y68C probably damaging Het
Vcan A T 13: 89,826,224 (GRCm39) H3193Q probably damaging Het
Vmn2r55 T C 7: 12,418,908 (GRCm39) Y4C probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,488,098 (GRCm39) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,523,470 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,428,036 (GRCm39) missense probably benign
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9581:Dnah12 UTSW 14 26,491,985 (GRCm39) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAAGCCAAATAAACATAGGAA -3'
(R):5'- TGGTATGAAAATGAAACATCTACACT -3'

Sequencing Primer
(F):5'- ATCTGAGTTGGACAGTACA -3'
(R):5'- TCTCCACATGCATGCCATAG -3'
Posted On 2021-11-19