Incidental Mutation 'R9050:Tln1'
ID 688288
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43531519-43562691 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 43549786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 542 (E542*)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000030187
AA Change: E542*
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: E542*

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125509
AA Change: E82*
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465
AA Change: E82*

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,379,540 Y332H probably benign Het
Apoc3 A G 9: 46,233,294 F77L probably benign Het
Atp5c1 A T 2: 10,064,238 D99E probably damaging Het
Atxn3 A T 12: 101,958,128 probably benign Het
Calcoco1 A G 15: 102,709,965 V463A probably damaging Het
Cby3 A G 11: 50,357,790 T20A possibly damaging Het
Cdhr2 A G 13: 54,735,320 D1256G probably benign Het
Cep350 A T 1: 155,862,941 D2385E possibly damaging Het
Clec9a G C 6: 129,419,598 A170P possibly damaging Het
Col5a3 C T 9: 20,786,395 G871S probably damaging Het
Fmo4 A G 1: 162,807,530 S159P probably benign Het
Gabbr2 A G 4: 46,798,659 F272L probably benign Het
Glp1r G A 17: 30,918,918 G108S probably damaging Het
Gm13078 A T 4: 143,726,759 T146S probably benign Het
Gm1673 G C 5: 33,983,530 A29P unknown Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Hps5 T C 7: 46,773,183 D574G probably benign Het
Il7 A G 3: 7,604,110 V22A possibly damaging Het
Kmt5c A G 7: 4,742,282 T91A probably benign Het
Mgea5 T C 19: 45,767,915 T430A probably damaging Het
Mrpl39 A C 16: 84,734,956 probably benign Het
Mtr T C 13: 12,216,862 D652G probably null Het
Neb C T 2: 52,189,889 V5768M probably damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nmrk1 T A 19: 18,641,175 M74K probably benign Het
Obox8 A G 7: 14,332,945 L58P unknown Het
Olfr1359 A G 13: 21,702,980 probably benign Het
Olfr1391 T C 11: 49,328,103 S231P possibly damaging Het
Olfr486 A C 7: 108,171,880 L288W probably damaging Het
Olfr99 A G 17: 37,279,929 Y164H probably damaging Het
Pcdhb17 T G 18: 37,487,233 V692G probably damaging Het
Pfas A G 11: 68,991,741 V829A probably benign Het
Pth A G 7: 113,385,836 V110A probably benign Het
Rabggta T A 14: 55,721,599 Q37L probably benign Het
Rin3 A G 12: 102,369,479 T550A probably damaging Het
Scn8a G A 15: 101,008,280 V785I possibly damaging Het
Sec24d T C 3: 123,350,725 V617A probably benign Het
Slc47a1 T C 11: 61,344,334 I558V probably benign Het
Slc6a15 A T 10: 103,416,655 M560L possibly damaging Het
Slfn9 G A 11: 82,988,294 T3I probably benign Het
Spag9 A G 11: 94,044,468 H35R probably damaging Het
Spats2 G T 15: 99,212,129 R469L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Ssx2ip C T 3: 146,438,757 S592L possibly damaging Het
Ston1 A G 17: 88,636,800 T545A probably benign Het
Suz12 C T 11: 80,022,197 L379F probably damaging Het
Tbc1d24 A T 17: 24,185,924 V82E possibly damaging Het
Tbc1d24 C A 17: 24,185,925 V82L probably benign Het
Thada A G 17: 84,429,201 I884T probably damaging Het
Togaram2 T C 17: 71,700,883 L401P probably damaging Het
Ttbk2 A T 2: 120,806,838 N115K probably benign Het
Tubgcp4 G A 2: 121,173,598 S40N probably benign Het
Wrn T C 8: 33,342,993 D157G probably damaging Het
Zer1 A T 2: 30,111,282 F70Y probably damaging Het
Zfp791 T C 8: 85,110,705 I177V possibly damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 splice site probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
R8416:Tln1 UTSW 4 43540116 missense probably benign 0.01
R8419:Tln1 UTSW 4 43536397 missense probably damaging 1.00
R8680:Tln1 UTSW 4 43553041 missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43534769 splice site probably benign
R8725:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43556383 missense probably benign
R8865:Tln1 UTSW 4 43538281 missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43549786 nonsense probably null
R9145:Tln1 UTSW 4 43536024 missense probably damaging 1.00
R9210:Tln1 UTSW 4 43536119 missense probably damaging 1.00
R9337:Tln1 UTSW 4 43532927 missense probably damaging 1.00
R9346:Tln1 UTSW 4 43546895 missense probably damaging 0.97
R9358:Tln1 UTSW 4 43532084 missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43542893 missense probably damaging 1.00
R9631:Tln1 UTSW 4 43545694 missense probably damaging 1.00
R9650:Tln1 UTSW 4 43545912 missense probably damaging 1.00
R9666:Tln1 UTSW 4 43542957 missense probably damaging 0.96
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTGCAGTTAGAGACGGACACAC -3'
(R):5'- CAGGCCACTCTGGATGACTTTG -3'

Sequencing Primer
(F):5'- GACGGACACACCCACAACTTG -3'
(R):5'- GGATGACTTTGAGACTCTACCC -3'
Posted On 2021-11-19