Incidental Mutation 'R9050:Obox8'
ID 688293
Institutional Source Beutler Lab
Gene Symbol Obox8
Ensembl Gene ENSMUSG00000099216
Gene Name oocyte specific homeobox 8
Synonyms Gm5585
MMRRC Submission 068876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 14065361-14067482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14066870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 58 (L58P)
Ref Sequence ENSEMBL: ENSMUSP00000138898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184356]
AlphaFold V9GWY9
Predicted Effect unknown
Transcript: ENSMUST00000184356
AA Change: L58P
SMART Domains Protein: ENSMUSP00000138898
Gene: ENSMUSG00000099216
AA Change: L58P

DomainStartEndE-ValueType
HOX 121 183 4.54e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,208,605 (GRCm39) Y332H probably benign Het
Apoc3 A G 9: 46,144,592 (GRCm39) F77L probably benign Het
Atp5f1c A T 2: 10,069,049 (GRCm39) D99E probably damaging Het
Atxn3 A T 12: 101,924,387 (GRCm39) probably benign Het
Calcoco1 A G 15: 102,618,400 (GRCm39) V463A probably damaging Het
Cby3 A G 11: 50,248,617 (GRCm39) T20A possibly damaging Het
Cdhr2 A G 13: 54,883,133 (GRCm39) D1256G probably benign Het
Cep350 A T 1: 155,738,687 (GRCm39) D2385E possibly damaging Het
Clec9a G C 6: 129,396,561 (GRCm39) A170P possibly damaging Het
Col5a3 C T 9: 20,697,691 (GRCm39) G871S probably damaging Het
Fmo4 A G 1: 162,635,099 (GRCm39) S159P probably benign Het
Gabbr2 A G 4: 46,798,659 (GRCm39) F272L probably benign Het
Glp1r G A 17: 31,137,892 (GRCm39) G108S probably damaging Het
Herpud1 T C 8: 95,117,454 (GRCm39) S13P probably benign Het
Hps5 T C 7: 46,422,607 (GRCm39) D574G probably benign Het
Il7 A G 3: 7,669,170 (GRCm39) V22A possibly damaging Het
Kmt5c A G 7: 4,745,281 (GRCm39) T91A probably benign Het
Mrpl39 A C 16: 84,531,844 (GRCm39) probably benign Het
Mtr T C 13: 12,231,748 (GRCm39) D652G probably null Het
Neb C T 2: 52,079,901 (GRCm39) V5768M probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nicol1 G C 5: 34,140,874 (GRCm39) A29P unknown Het
Nmrk1 T A 19: 18,618,539 (GRCm39) M74K probably benign Het
Oga T C 19: 45,756,354 (GRCm39) T430A probably damaging Het
Or1o4 A G 17: 37,590,820 (GRCm39) Y164H probably damaging Het
Or2b2 A G 13: 21,887,150 (GRCm39) probably benign Het
Or2y1e T C 11: 49,218,930 (GRCm39) S231P possibly damaging Het
Or5p62 A C 7: 107,771,087 (GRCm39) L288W probably damaging Het
Pcdhb17 T G 18: 37,620,286 (GRCm39) V692G probably damaging Het
Pfas A G 11: 68,882,567 (GRCm39) V829A probably benign Het
Pramel24 A T 4: 143,453,329 (GRCm39) T146S probably benign Het
Pth A G 7: 112,985,043 (GRCm39) V110A probably benign Het
Rabggta T A 14: 55,959,056 (GRCm39) Q37L probably benign Het
Rin3 A G 12: 102,335,738 (GRCm39) T550A probably damaging Het
Scn8a G A 15: 100,906,161 (GRCm39) V785I possibly damaging Het
Sec24d T C 3: 123,144,374 (GRCm39) V617A probably benign Het
Slc47a1 T C 11: 61,235,160 (GRCm39) I558V probably benign Het
Slc6a15 A T 10: 103,252,516 (GRCm39) M560L possibly damaging Het
Slfn9 G A 11: 82,879,120 (GRCm39) T3I probably benign Het
Spag9 A G 11: 93,935,294 (GRCm39) H35R probably damaging Het
Spats2 G T 15: 99,110,010 (GRCm39) R469L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Ssx2ip C T 3: 146,144,512 (GRCm39) S592L possibly damaging Het
Ston1 A G 17: 88,944,228 (GRCm39) T545A probably benign Het
Suz12 C T 11: 79,913,023 (GRCm39) L379F probably damaging Het
Tbc1d24 C A 17: 24,404,899 (GRCm39) V82L probably benign Het
Tbc1d24 A T 17: 24,404,898 (GRCm39) V82E possibly damaging Het
Thada A G 17: 84,736,629 (GRCm39) I884T probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Togaram2 T C 17: 72,007,878 (GRCm39) L401P probably damaging Het
Ttbk2 A T 2: 120,637,319 (GRCm39) N115K probably benign Het
Tubgcp4 G A 2: 121,004,079 (GRCm39) S40N probably benign Het
Wrn T C 8: 33,833,021 (GRCm39) D157G probably damaging Het
Zer1 A T 2: 30,001,294 (GRCm39) F70Y probably damaging Het
Zfp791 T C 8: 85,837,334 (GRCm39) I177V possibly damaging Het
Other mutations in Obox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4664:Obox8 UTSW 7 14,066,771 (GRCm39) missense possibly damaging 0.47
R5128:Obox8 UTSW 7 14,066,015 (GRCm39) missense probably damaging 1.00
R5265:Obox8 UTSW 7 14,065,954 (GRCm39) missense probably benign 0.09
R7067:Obox8 UTSW 7 14,066,979 (GRCm39) missense possibly damaging 0.53
R7101:Obox8 UTSW 7 14,066,752 (GRCm39) nonsense probably null
R8271:Obox8 UTSW 7 14,065,928 (GRCm39) missense probably benign 0.02
R8790:Obox8 UTSW 7 14,066,908 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCGGTAACATGTGGCCTTG -3'
(R):5'- GAACCCTCTGCATAGTATGTCAG -3'

Sequencing Primer
(F):5'- CTTGGAAGGACCTGAGGAGCC -3'
(R):5'- CCCTCTGCATAGTATGTCAGAAAGG -3'
Posted On 2021-11-19