Incidental Mutation 'R9050:Olfr486'
ID 688295
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 108171880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 288 (L288W)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect probably damaging
Transcript: ENSMUST00000072035
AA Change: L288W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: L288W

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,379,540 Y332H probably benign Het
Apoc3 A G 9: 46,233,294 F77L probably benign Het
Atp5c1 A T 2: 10,064,238 D99E probably damaging Het
Calcoco1 A G 15: 102,709,965 V463A probably damaging Het
Cby3 A G 11: 50,357,790 T20A possibly damaging Het
Cdhr2 A G 13: 54,735,320 D1256G probably benign Het
Cep350 A T 1: 155,862,941 D2385E possibly damaging Het
Col5a3 C T 9: 20,786,395 G871S probably damaging Het
Fmo4 A G 1: 162,807,530 S159P probably benign Het
Gabbr2 A G 4: 46,798,659 F272L probably benign Het
Glp1r G A 17: 30,918,918 G108S probably damaging Het
Gm13078 A T 4: 143,726,759 T146S probably benign Het
Gm1673 G C 5: 33,983,530 A29P unknown Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Hps5 T C 7: 46,773,183 D574G probably benign Het
Il7 A G 3: 7,604,110 V22A possibly damaging Het
Kmt5c A G 7: 4,742,282 T91A probably benign Het
Mgea5 T C 19: 45,767,915 T430A probably damaging Het
Mtr T C 13: 12,216,862 D652G probably null Het
Neb C T 2: 52,189,889 V5768M probably damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nmrk1 T A 19: 18,641,175 M74K probably benign Het
Obox8 A G 7: 14,332,945 L58P unknown Het
Olfr1391 T C 11: 49,328,103 S231P possibly damaging Het
Olfr99 A G 17: 37,279,929 Y164H probably damaging Het
Pcdhb17 T G 18: 37,487,233 V692G probably damaging Het
Pfas A G 11: 68,991,741 V829A probably benign Het
Pth A G 7: 113,385,836 V110A probably benign Het
Rabggta T A 14: 55,721,599 Q37L probably benign Het
Rin3 A G 12: 102,369,479 T550A probably damaging Het
Scn8a G A 15: 101,008,280 V785I possibly damaging Het
Sec24d T C 3: 123,350,725 V617A probably benign Het
Slc47a1 T C 11: 61,344,334 I558V probably benign Het
Slc6a15 A T 10: 103,416,655 M560L possibly damaging Het
Slfn9 G A 11: 82,988,294 T3I probably benign Het
Spag9 A G 11: 94,044,468 H35R probably damaging Het
Spats2 G T 15: 99,212,129 R469L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Ssx2ip C T 3: 146,438,757 S592L possibly damaging Het
Ston1 A G 17: 88,636,800 T545A probably benign Het
Suz12 C T 11: 80,022,197 L379F probably damaging Het
Tbc1d24 A T 17: 24,185,924 V82E possibly damaging Het
Tbc1d24 C A 17: 24,185,925 V82L probably benign Het
Thada A G 17: 84,429,201 I884T probably damaging Het
Tln1 C A 4: 43,549,786 E542* probably null Het
Togaram2 T C 17: 71,700,883 L401P probably damaging Het
Ttbk2 A T 2: 120,806,838 N115K probably benign Het
Tubgcp4 G A 2: 121,173,598 S40N probably benign Het
Wrn T C 8: 33,342,993 D157G probably damaging Het
Zer1 A T 2: 30,111,282 F70Y probably damaging Het
Zfp791 T C 8: 85,110,705 I177V possibly damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7499:Olfr486 UTSW 7 108171800 makesense probably null
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R8807:Olfr486 UTSW 7 108172645 missense possibly damaging 0.93
R9244:Olfr486 UTSW 7 108172645 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACCTTGGCTTATAACCAAACCTG -3'
(R):5'- CAGGCTCATTTACAATGACCAC -3'

Sequencing Primer
(F):5'- CTTGGCTTATAACCAAACCTGATATG -3'
(R):5'- CATCTTGAAGATTCGTTCCACTGAGG -3'
Posted On 2021-11-19