Incidental Mutation 'R9050:Slc6a15'
ID 688303
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 068876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103252516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 560 (M560L)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect possibly damaging
Transcript: ENSMUST00000074204
AA Change: M560L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: M560L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179636
AA Change: M560L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: M560L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Meta Mutation Damage Score 0.6090 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,208,605 (GRCm39) Y332H probably benign Het
Apoc3 A G 9: 46,144,592 (GRCm39) F77L probably benign Het
Atp5f1c A T 2: 10,069,049 (GRCm39) D99E probably damaging Het
Atxn3 A T 12: 101,924,387 (GRCm39) probably benign Het
Calcoco1 A G 15: 102,618,400 (GRCm39) V463A probably damaging Het
Cby3 A G 11: 50,248,617 (GRCm39) T20A possibly damaging Het
Cdhr2 A G 13: 54,883,133 (GRCm39) D1256G probably benign Het
Cep350 A T 1: 155,738,687 (GRCm39) D2385E possibly damaging Het
Clec9a G C 6: 129,396,561 (GRCm39) A170P possibly damaging Het
Col5a3 C T 9: 20,697,691 (GRCm39) G871S probably damaging Het
Fmo4 A G 1: 162,635,099 (GRCm39) S159P probably benign Het
Gabbr2 A G 4: 46,798,659 (GRCm39) F272L probably benign Het
Glp1r G A 17: 31,137,892 (GRCm39) G108S probably damaging Het
Herpud1 T C 8: 95,117,454 (GRCm39) S13P probably benign Het
Hps5 T C 7: 46,422,607 (GRCm39) D574G probably benign Het
Il7 A G 3: 7,669,170 (GRCm39) V22A possibly damaging Het
Kmt5c A G 7: 4,745,281 (GRCm39) T91A probably benign Het
Mrpl39 A C 16: 84,531,844 (GRCm39) probably benign Het
Mtr T C 13: 12,231,748 (GRCm39) D652G probably null Het
Neb C T 2: 52,079,901 (GRCm39) V5768M probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nicol1 G C 5: 34,140,874 (GRCm39) A29P unknown Het
Nmrk1 T A 19: 18,618,539 (GRCm39) M74K probably benign Het
Obox8 A G 7: 14,066,870 (GRCm39) L58P unknown Het
Oga T C 19: 45,756,354 (GRCm39) T430A probably damaging Het
Or1o4 A G 17: 37,590,820 (GRCm39) Y164H probably damaging Het
Or2b2 A G 13: 21,887,150 (GRCm39) probably benign Het
Or2y1e T C 11: 49,218,930 (GRCm39) S231P possibly damaging Het
Or5p62 A C 7: 107,771,087 (GRCm39) L288W probably damaging Het
Pcdhb17 T G 18: 37,620,286 (GRCm39) V692G probably damaging Het
Pfas A G 11: 68,882,567 (GRCm39) V829A probably benign Het
Pramel24 A T 4: 143,453,329 (GRCm39) T146S probably benign Het
Pth A G 7: 112,985,043 (GRCm39) V110A probably benign Het
Rabggta T A 14: 55,959,056 (GRCm39) Q37L probably benign Het
Rin3 A G 12: 102,335,738 (GRCm39) T550A probably damaging Het
Scn8a G A 15: 100,906,161 (GRCm39) V785I possibly damaging Het
Sec24d T C 3: 123,144,374 (GRCm39) V617A probably benign Het
Slc47a1 T C 11: 61,235,160 (GRCm39) I558V probably benign Het
Slfn9 G A 11: 82,879,120 (GRCm39) T3I probably benign Het
Spag9 A G 11: 93,935,294 (GRCm39) H35R probably damaging Het
Spats2 G T 15: 99,110,010 (GRCm39) R469L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Ssx2ip C T 3: 146,144,512 (GRCm39) S592L possibly damaging Het
Ston1 A G 17: 88,944,228 (GRCm39) T545A probably benign Het
Suz12 C T 11: 79,913,023 (GRCm39) L379F probably damaging Het
Tbc1d24 C A 17: 24,404,899 (GRCm39) V82L probably benign Het
Tbc1d24 A T 17: 24,404,898 (GRCm39) V82E possibly damaging Het
Thada A G 17: 84,736,629 (GRCm39) I884T probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Togaram2 T C 17: 72,007,878 (GRCm39) L401P probably damaging Het
Ttbk2 A T 2: 120,637,319 (GRCm39) N115K probably benign Het
Tubgcp4 G A 2: 121,004,079 (GRCm39) S40N probably benign Het
Wrn T C 8: 33,833,021 (GRCm39) D157G probably damaging Het
Zer1 A T 2: 30,001,294 (GRCm39) F70Y probably damaging Het
Zfp791 T C 8: 85,837,334 (GRCm39) I177V possibly damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCATAGCTGTATGTATACATGT -3'
(R):5'- TGCAGCAGTGGGAGGTATATATTATAA -3'

Sequencing Primer
(F):5'- CCTCACATGCTTGAATGGTAGGC -3'
(R):5'- ACAAAGTGGTGGCATATTTTCAC -3'
Posted On 2021-11-19