Incidental Mutation 'R9050:Spats2'
ID 688315
Institutional Source Beutler Lab
Gene Symbol Spats2
Ensembl Gene ENSMUSG00000051934
Gene Name spermatogenesis associated, serine-rich 2
Synonyms Scr59, 59kDa, 2700012F11Rik, p59
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99125916-99213215 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 99212129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 469 (R469L)
Ref Sequence ENSEMBL: ENSMUSP00000070549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063517]
AlphaFold Q8K1N4
Predicted Effect possibly damaging
Transcript: ENSMUST00000063517
AA Change: R469L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070549
Gene: ENSMUSG00000051934
AA Change: R469L

DomainStartEndE-ValueType
Pfam:DUF1387 81 385 8.1e-125 PFAM
low complexity region 391 413 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,379,540 Y332H probably benign Het
Apoc3 A G 9: 46,233,294 F77L probably benign Het
Atp5c1 A T 2: 10,064,238 D99E probably damaging Het
Atxn3 A T 12: 101,958,128 probably benign Het
Calcoco1 A G 15: 102,709,965 V463A probably damaging Het
Cby3 A G 11: 50,357,790 T20A possibly damaging Het
Cdhr2 A G 13: 54,735,320 D1256G probably benign Het
Cep350 A T 1: 155,862,941 D2385E possibly damaging Het
Clec9a G C 6: 129,419,598 A170P possibly damaging Het
Col5a3 C T 9: 20,786,395 G871S probably damaging Het
Fmo4 A G 1: 162,807,530 S159P probably benign Het
Gabbr2 A G 4: 46,798,659 F272L probably benign Het
Glp1r G A 17: 30,918,918 G108S probably damaging Het
Gm13078 A T 4: 143,726,759 T146S probably benign Het
Gm1673 G C 5: 33,983,530 A29P unknown Het
Herpud1 T C 8: 94,390,826 S13P probably benign Het
Hps5 T C 7: 46,773,183 D574G probably benign Het
Il7 A G 3: 7,604,110 V22A possibly damaging Het
Kmt5c A G 7: 4,742,282 T91A probably benign Het
Mgea5 T C 19: 45,767,915 T430A probably damaging Het
Mrpl39 A C 16: 84,734,956 probably benign Het
Mtr T C 13: 12,216,862 D652G probably null Het
Neb C T 2: 52,189,889 V5768M probably damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Nmrk1 T A 19: 18,641,175 M74K probably benign Het
Obox8 A G 7: 14,332,945 L58P unknown Het
Olfr1359 A G 13: 21,702,980 probably benign Het
Olfr1391 T C 11: 49,328,103 S231P possibly damaging Het
Olfr486 A C 7: 108,171,880 L288W probably damaging Het
Olfr99 A G 17: 37,279,929 Y164H probably damaging Het
Pcdhb17 T G 18: 37,487,233 V692G probably damaging Het
Pfas A G 11: 68,991,741 V829A probably benign Het
Pth A G 7: 113,385,836 V110A probably benign Het
Rabggta T A 14: 55,721,599 Q37L probably benign Het
Rin3 A G 12: 102,369,479 T550A probably damaging Het
Scn8a G A 15: 101,008,280 V785I possibly damaging Het
Sec24d T C 3: 123,350,725 V617A probably benign Het
Slc47a1 T C 11: 61,344,334 I558V probably benign Het
Slc6a15 A T 10: 103,416,655 M560L possibly damaging Het
Slfn9 G A 11: 82,988,294 T3I probably benign Het
Spag9 A G 11: 94,044,468 H35R probably damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Ssx2ip C T 3: 146,438,757 S592L possibly damaging Het
Ston1 A G 17: 88,636,800 T545A probably benign Het
Suz12 C T 11: 80,022,197 L379F probably damaging Het
Tbc1d24 A T 17: 24,185,924 V82E possibly damaging Het
Tbc1d24 C A 17: 24,185,925 V82L probably benign Het
Thada A G 17: 84,429,201 I884T probably damaging Het
Tln1 C A 4: 43,549,786 E542* probably null Het
Togaram2 T C 17: 71,700,883 L401P probably damaging Het
Ttbk2 A T 2: 120,806,838 N115K probably benign Het
Tubgcp4 G A 2: 121,173,598 S40N probably benign Het
Wrn T C 8: 33,342,993 D157G probably damaging Het
Zer1 A T 2: 30,111,282 F70Y probably damaging Het
Zfp791 T C 8: 85,110,705 I177V possibly damaging Het
Other mutations in Spats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Spats2 APN 15 99180593 missense possibly damaging 0.88
IGL00696:Spats2 APN 15 99210894 missense probably damaging 1.00
IGL01524:Spats2 APN 15 99212246 missense probably benign 0.00
IGL02496:Spats2 APN 15 99173448 missense probably damaging 1.00
IGL03031:Spats2 APN 15 99180688 missense probably benign 0.00
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0067:Spats2 UTSW 15 99212287 missense possibly damaging 0.64
R0630:Spats2 UTSW 15 99186028 splice site probably null
R1577:Spats2 UTSW 15 99178452 missense possibly damaging 0.94
R2012:Spats2 UTSW 15 99178494 missense probably damaging 0.97
R2229:Spats2 UTSW 15 99174453 critical splice donor site probably null
R2982:Spats2 UTSW 15 99211046 missense probably benign
R3743:Spats2 UTSW 15 99210914 missense probably benign 0.09
R4679:Spats2 UTSW 15 99180722 missense possibly damaging 0.62
R4857:Spats2 UTSW 15 99174420 missense probably damaging 1.00
R4962:Spats2 UTSW 15 99212276 missense probably benign 0.00
R5291:Spats2 UTSW 15 99178541 missense probably benign 0.16
R6879:Spats2 UTSW 15 99173412 missense probably damaging 1.00
R7187:Spats2 UTSW 15 99212173 missense probably benign 0.02
R7476:Spats2 UTSW 15 99212141 missense probably benign 0.00
R8084:Spats2 UTSW 15 99167080 missense possibly damaging 0.94
R8239:Spats2 UTSW 15 99208895 missense probably damaging 1.00
R8338:Spats2 UTSW 15 99178459 missense probably damaging 1.00
R8979:Spats2 UTSW 15 99212242 missense possibly damaging 0.92
R9013:Spats2 UTSW 15 99199247 missense probably damaging 1.00
R9433:Spats2 UTSW 15 99178565 nonsense probably null
X0062:Spats2 UTSW 15 99178532 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTTTGCTATCAGAACACTGC -3'
(R):5'- TCAGGAGTTCGCAGCTTCAG -3'

Sequencing Primer
(F):5'- TTGCTATCAGAACACTGCTATAACC -3'
(R):5'- AGCCCCTTTTTGAACGAAGG -3'
Posted On 2021-11-19