Incidental Mutation 'R9050:Glp1r'
ID 688320
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Name glucagon-like peptide 1 receptor
Synonyms GLP-1R, GLP1Rc
MMRRC Submission 068876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9050 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 31120841-31155484 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31137892 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 108 (G108S)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
AlphaFold O35659
Predicted Effect probably damaging
Transcript: ENSMUST00000114574
AA Change: G108S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: G108S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Meta Mutation Damage Score 0.9060 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T C 9: 122,208,605 (GRCm39) Y332H probably benign Het
Apoc3 A G 9: 46,144,592 (GRCm39) F77L probably benign Het
Atp5f1c A T 2: 10,069,049 (GRCm39) D99E probably damaging Het
Atxn3 A T 12: 101,924,387 (GRCm39) probably benign Het
Calcoco1 A G 15: 102,618,400 (GRCm39) V463A probably damaging Het
Cby3 A G 11: 50,248,617 (GRCm39) T20A possibly damaging Het
Cdhr2 A G 13: 54,883,133 (GRCm39) D1256G probably benign Het
Cep350 A T 1: 155,738,687 (GRCm39) D2385E possibly damaging Het
Clec9a G C 6: 129,396,561 (GRCm39) A170P possibly damaging Het
Col5a3 C T 9: 20,697,691 (GRCm39) G871S probably damaging Het
Fmo4 A G 1: 162,635,099 (GRCm39) S159P probably benign Het
Gabbr2 A G 4: 46,798,659 (GRCm39) F272L probably benign Het
Herpud1 T C 8: 95,117,454 (GRCm39) S13P probably benign Het
Hps5 T C 7: 46,422,607 (GRCm39) D574G probably benign Het
Il7 A G 3: 7,669,170 (GRCm39) V22A possibly damaging Het
Kmt5c A G 7: 4,745,281 (GRCm39) T91A probably benign Het
Mrpl39 A C 16: 84,531,844 (GRCm39) probably benign Het
Mtr T C 13: 12,231,748 (GRCm39) D652G probably null Het
Neb C T 2: 52,079,901 (GRCm39) V5768M probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nicol1 G C 5: 34,140,874 (GRCm39) A29P unknown Het
Nmrk1 T A 19: 18,618,539 (GRCm39) M74K probably benign Het
Obox8 A G 7: 14,066,870 (GRCm39) L58P unknown Het
Oga T C 19: 45,756,354 (GRCm39) T430A probably damaging Het
Or1o4 A G 17: 37,590,820 (GRCm39) Y164H probably damaging Het
Or2b2 A G 13: 21,887,150 (GRCm39) probably benign Het
Or2y1e T C 11: 49,218,930 (GRCm39) S231P possibly damaging Het
Or5p62 A C 7: 107,771,087 (GRCm39) L288W probably damaging Het
Pcdhb17 T G 18: 37,620,286 (GRCm39) V692G probably damaging Het
Pfas A G 11: 68,882,567 (GRCm39) V829A probably benign Het
Pramel24 A T 4: 143,453,329 (GRCm39) T146S probably benign Het
Pth A G 7: 112,985,043 (GRCm39) V110A probably benign Het
Rabggta T A 14: 55,959,056 (GRCm39) Q37L probably benign Het
Rin3 A G 12: 102,335,738 (GRCm39) T550A probably damaging Het
Scn8a G A 15: 100,906,161 (GRCm39) V785I possibly damaging Het
Sec24d T C 3: 123,144,374 (GRCm39) V617A probably benign Het
Slc47a1 T C 11: 61,235,160 (GRCm39) I558V probably benign Het
Slc6a15 A T 10: 103,252,516 (GRCm39) M560L possibly damaging Het
Slfn9 G A 11: 82,879,120 (GRCm39) T3I probably benign Het
Spag9 A G 11: 93,935,294 (GRCm39) H35R probably damaging Het
Spats2 G T 15: 99,110,010 (GRCm39) R469L possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Ssx2ip C T 3: 146,144,512 (GRCm39) S592L possibly damaging Het
Ston1 A G 17: 88,944,228 (GRCm39) T545A probably benign Het
Suz12 C T 11: 79,913,023 (GRCm39) L379F probably damaging Het
Tbc1d24 C A 17: 24,404,899 (GRCm39) V82L probably benign Het
Tbc1d24 A T 17: 24,404,898 (GRCm39) V82E possibly damaging Het
Thada A G 17: 84,736,629 (GRCm39) I884T probably damaging Het
Tln1 C A 4: 43,549,786 (GRCm39) E542* probably null Het
Togaram2 T C 17: 72,007,878 (GRCm39) L401P probably damaging Het
Ttbk2 A T 2: 120,637,319 (GRCm39) N115K probably benign Het
Tubgcp4 G A 2: 121,004,079 (GRCm39) S40N probably benign Het
Wrn T C 8: 33,833,021 (GRCm39) D157G probably damaging Het
Zer1 A T 2: 30,001,294 (GRCm39) F70Y probably damaging Het
Zfp791 T C 8: 85,837,334 (GRCm39) I177V possibly damaging Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 31,120,891 (GRCm39) missense possibly damaging 0.96
IGL00516:Glp1r APN 17 31,144,532 (GRCm39) missense probably damaging 1.00
IGL00653:Glp1r APN 17 31,149,734 (GRCm39) missense probably damaging 1.00
IGL00917:Glp1r APN 17 31,138,443 (GRCm39) splice site probably benign
IGL02005:Glp1r APN 17 31,143,585 (GRCm39) missense probably benign 0.03
IGL02411:Glp1r APN 17 31,143,485 (GRCm39) missense probably damaging 1.00
IGL02889:Glp1r APN 17 31,150,118 (GRCm39) splice site probably benign
IGL02928:Glp1r APN 17 31,137,911 (GRCm39) missense probably benign 0.00
N/A:Glp1r UTSW 17 31,150,257 (GRCm39) missense probably damaging 0.98
R0135:Glp1r UTSW 17 31,143,551 (GRCm39) missense probably benign 0.00
R0395:Glp1r UTSW 17 31,155,312 (GRCm39) missense probably benign 0.34
R0481:Glp1r UTSW 17 31,150,191 (GRCm39) missense probably benign 0.03
R0602:Glp1r UTSW 17 31,128,201 (GRCm39) missense probably benign 0.12
R0841:Glp1r UTSW 17 31,138,406 (GRCm39) missense probably benign 0.01
R1145:Glp1r UTSW 17 31,138,406 (GRCm39) missense probably benign 0.01
R1145:Glp1r UTSW 17 31,138,406 (GRCm39) missense probably benign 0.01
R1232:Glp1r UTSW 17 31,137,905 (GRCm39) missense probably benign
R1804:Glp1r UTSW 17 31,149,687 (GRCm39) splice site probably null
R1846:Glp1r UTSW 17 31,148,909 (GRCm39) critical splice acceptor site probably null
R1982:Glp1r UTSW 17 31,144,601 (GRCm39) nonsense probably null
R1990:Glp1r UTSW 17 31,149,722 (GRCm39) missense possibly damaging 0.53
R2091:Glp1r UTSW 17 31,144,523 (GRCm39) missense probably damaging 0.97
R3432:Glp1r UTSW 17 31,143,531 (GRCm39) missense probably damaging 1.00
R4456:Glp1r UTSW 17 31,137,949 (GRCm39) nonsense probably null
R4488:Glp1r UTSW 17 31,137,905 (GRCm39) missense probably benign
R4610:Glp1r UTSW 17 31,150,221 (GRCm39) missense probably benign 0.03
R4884:Glp1r UTSW 17 31,155,240 (GRCm39) missense probably damaging 1.00
R5055:Glp1r UTSW 17 31,137,861 (GRCm39) missense probably benign
R6358:Glp1r UTSW 17 31,151,618 (GRCm39) missense probably benign 0.07
R6359:Glp1r UTSW 17 31,148,946 (GRCm39) missense probably damaging 1.00
R6490:Glp1r UTSW 17 31,143,546 (GRCm39) missense probably damaging 0.98
R6698:Glp1r UTSW 17 31,155,375 (GRCm39) missense probably damaging 1.00
R7063:Glp1r UTSW 17 31,144,532 (GRCm39) missense probably damaging 1.00
R7165:Glp1r UTSW 17 31,128,297 (GRCm39) missense probably benign 0.23
R7293:Glp1r UTSW 17 31,143,599 (GRCm39) missense probably benign 0.00
R7646:Glp1r UTSW 17 31,155,257 (GRCm39) missense probably benign 0.38
R7655:Glp1r UTSW 17 31,149,572 (GRCm39) critical splice donor site probably null
R7656:Glp1r UTSW 17 31,149,572 (GRCm39) critical splice donor site probably null
R7686:Glp1r UTSW 17 31,144,633 (GRCm39) missense probably damaging 1.00
R8531:Glp1r UTSW 17 31,143,531 (GRCm39) missense probably damaging 1.00
X0064:Glp1r UTSW 17 31,138,437 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCGATTCCTGTTACTAACTCAGAAG -3'
(R):5'- ACCTTTGGCCAGATAGCAGG -3'

Sequencing Primer
(F):5'- GTCAGCTCTAATGGAGCA -3'
(R):5'- CTGATGATGTGACAGCAACTGCC -3'
Posted On 2021-11-19