Incidental Mutation 'R9051:Ret'
ID 688366
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission 068877-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R9051 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 118142888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 929 (Y929*)
Ref Sequence ENSEMBL: ENSMUSP00000032201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
PDB Structure Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000032201
AA Change: Y929*
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: Y929*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088790
AA Change: Y929*
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: Y929*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,285,232 (GRCm39) T3289S probably damaging Het
Actr1b G T 1: 36,740,534 (GRCm39) Q240K probably benign Het
Adamts19 T C 18: 59,034,048 (GRCm39) V341A probably damaging Het
Akirin2 C A 4: 34,551,148 (GRCm39) S35* probably null Het
Alg3 G T 16: 20,427,765 (GRCm39) Q90K probably benign Het
Alox12 C T 11: 70,138,153 (GRCm39) R394H possibly damaging Het
Ankrd17 A C 5: 90,411,134 (GRCm39) M1387R probably damaging Het
Anp32b T G 4: 46,468,592 (GRCm39) F121V possibly damaging Het
Atp2b2 A G 6: 113,740,566 (GRCm39) V815A probably damaging Het
Atxn7l1 T C 12: 33,417,420 (GRCm39) L527S probably benign Het
B9d2 C T 7: 25,385,462 (GRCm39) L91F possibly damaging Het
Bcl2l11 T A 2: 128,000,221 (GRCm39) I188N probably damaging Het
Bnc2 A C 4: 84,210,138 (GRCm39) S744A probably benign Het
Casr T G 16: 36,330,414 (GRCm39) M307L probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cd109 TTATA TTATATATA 9: 78,619,813 (GRCm39) probably benign Het
Cd22 A G 7: 30,575,449 (GRCm39) S198P probably benign Het
Cd37 C A 7: 44,886,622 (GRCm39) V99L probably benign Het
Cdkn1c A G 7: 143,013,964 (GRCm39) S161P possibly damaging Het
Chi3l1 G T 1: 134,111,919 (GRCm39) probably null Het
Col4a2 T C 8: 11,498,198 (GRCm39) F1669S probably damaging Het
Dchs2 A T 3: 83,261,493 (GRCm39) H2587L probably benign Het
Ddx19a A T 8: 111,710,228 (GRCm39) M124K probably benign Het
Dnhd1 A T 7: 105,341,933 (GRCm39) H1244L possibly damaging Het
Dnpep G A 1: 75,292,329 (GRCm39) P165L probably damaging Het
Dpp3 T C 19: 4,973,172 (GRCm39) R141G probably benign Het
Dpysl3 T C 18: 43,462,814 (GRCm39) D521G probably damaging Het
Dusp4 T A 8: 35,284,345 (GRCm39) M220K probably damaging Het
Duxf4 G A 10: 58,071,711 (GRCm39) P168S probably damaging Het
Edc4 T A 8: 106,613,833 (GRCm39) L391Q probably damaging Het
Edrf1 A C 7: 133,273,207 (GRCm39) I1221L probably benign Het
Elavl2 A G 4: 91,199,847 (GRCm39) L12P probably benign Het
Fastkd3 T A 13: 68,733,071 (GRCm39) V464D probably damaging Het
Flt4 C A 11: 49,527,598 (GRCm39) N920K probably benign Het
Gimap3 T C 6: 48,742,259 (GRCm39) T224A probably benign Het
Gm9772 T A 17: 22,225,565 (GRCm39) K112* probably null Het
Gp5 C A 16: 30,127,976 (GRCm39) V233L Het
Gpr25 A T 1: 136,188,026 (GRCm39) W196R probably benign Het
Hs3st4 G A 7: 123,582,680 (GRCm39) G93S probably damaging Het
Igsf10 A G 3: 59,236,668 (GRCm39) L1171S probably benign Het
Itgb7 C T 15: 102,126,359 (GRCm39) G526S possibly damaging Het
Kcnh8 G A 17: 53,141,642 (GRCm39) C295Y probably damaging Het
Klhl8 A G 5: 104,015,709 (GRCm39) probably null Het
Krt1c T A 15: 101,726,317 (GRCm39) I74F unknown Het
Lamp5 G T 2: 135,911,054 (GRCm39) M262I probably benign Het
Lrp5 G T 19: 3,680,156 (GRCm39) R443S possibly damaging Het
Lrrc66 G T 5: 73,765,267 (GRCm39) A592E probably benign Het
Lrrc66 C T 5: 73,765,268 (GRCm39) A592T probably benign Het
Mettl23 T A 11: 116,744,865 (GRCm39) V93D unknown Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mkrn2os G A 6: 115,562,325 (GRCm39) R213W probably benign Het
Mrps36 T A 13: 100,877,715 (GRCm39) I22L probably damaging Het
Msantd5f4 A G 4: 73,557,185 (GRCm39) N6S possibly damaging Het
Myocd T C 11: 65,077,795 (GRCm39) R667G probably benign Het
Ncapg T A 5: 45,853,140 (GRCm39) L869M probably damaging Het
Ndst3 T C 3: 123,465,549 (GRCm39) N141S probably benign Het
Neu2 A T 1: 87,524,965 (GRCm39) R317* probably null Het
Nf1 G T 11: 79,364,168 (GRCm39) V1533F probably damaging Het
Npy4r T A 14: 33,869,083 (GRCm39) R68S possibly damaging Het
Nr1h5 T C 3: 102,853,427 (GRCm39) H360R probably null Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or4f14c T C 2: 111,941,441 (GRCm39) D52G probably damaging Het
Or9s15 T C 1: 92,524,978 (GRCm39) S246P probably damaging Het
Osmr A C 15: 6,882,027 (GRCm39) V39G probably damaging Het
Plekhm2 T C 4: 141,359,732 (GRCm39) D345G possibly damaging Het
Prkaa2 G T 4: 104,906,600 (GRCm39) S165* probably null Het
Qser1 A T 2: 104,593,292 (GRCm39) F1575Y possibly damaging Het
Rasl11a C A 5: 146,782,107 (GRCm39) D27E probably benign Het
Samd9l T A 6: 3,373,493 (GRCm39) E1256V probably benign Het
Scnn1g A G 7: 121,341,566 (GRCm39) I243V possibly damaging Het
Slc6a3 C T 13: 73,718,031 (GRCm39) R514* probably null Het
Sorcs3 C T 19: 48,194,809 (GRCm39) A64V probably benign Het
Sos1 G T 17: 80,715,723 (GRCm39) N1011K probably benign Het
Srbd1 C A 17: 86,428,115 (GRCm39) A373S possibly damaging Het
Tas1r1 C T 4: 152,122,833 (GRCm39) W4* probably null Het
Tcf15 C T 2: 151,985,690 (GRCm39) R49C probably damaging Het
Tex30 A G 1: 44,127,136 (GRCm39) V124A possibly damaging Het
Tgif1 T C 17: 71,151,882 (GRCm39) D243G Het
Tgtp1 T G 11: 48,877,916 (GRCm39) D263A probably damaging Het
Themis3 T A 17: 66,862,864 (GRCm39) T365S probably benign Het
Thoc2l C A 5: 104,666,818 (GRCm39) P447T probably benign Het
Tprg1 A T 16: 25,231,662 (GRCm39) I213F probably damaging Het
Traf4 A T 11: 78,052,005 (GRCm39) C160S probably damaging Het
Trio T C 15: 27,732,770 (GRCm39) E3037G possibly damaging Het
Ttbk2 G T 2: 120,575,911 (GRCm39) S1022* probably null Het
Ttc6 T C 12: 57,783,949 (GRCm39) Y1803H probably damaging Het
Ttn A C 2: 76,549,452 (GRCm39) Y31742D probably benign Het
Ttn G T 2: 76,617,595 (GRCm39) P16292Q probably damaging Het
Ubr5 A G 15: 38,002,503 (GRCm39) V1510A Het
Vac14 A G 8: 111,379,869 (GRCm39) D389G probably benign Het
Vwa8 A G 14: 79,324,150 (GRCm39) D1151G probably benign Het
Zfp608 T C 18: 55,032,266 (GRCm39) N558S probably damaging Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CACTGTGGTTGGCAGAACTG -3'
(R):5'- TTGGTTATAGGACTCAAGAGCC -3'

Sequencing Primer
(F):5'- AGAACTGCTGCCTGGGC -3'
(R):5'- GAGCCATAGTCTCTCCAGAGCTAG -3'
Posted On 2021-11-19