Incidental Mutation 'R9051:Krt2'
ID 688403
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R9051 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101817882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 74 (I74F)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect unknown
Transcript: ENSMUST00000023712
AA Change: I74F
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: I74F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,335,232 T3289S probably damaging Het
Actr1b G T 1: 36,701,453 Q240K probably benign Het
Adamts19 T C 18: 58,900,976 V341A probably damaging Het
Akirin2 C A 4: 34,551,148 S35* probably null Het
Alg3 G T 16: 20,609,015 Q90K probably benign Het
Alox12 C T 11: 70,247,327 R394H possibly damaging Het
Ankrd17 A C 5: 90,263,275 M1387R probably damaging Het
Anp32b T G 4: 46,468,592 F121V possibly damaging Het
Atp2b2 A G 6: 113,763,605 V815A probably damaging Het
Atxn7l1 T C 12: 33,367,421 L527S probably benign Het
B9d2 C T 7: 25,686,037 L91F possibly damaging Het
BC005561 C A 5: 104,518,952 P447T probably benign Het
Bcl2l11 T A 2: 128,158,301 I188N probably damaging Het
Bnc2 A C 4: 84,291,901 S744A probably benign Het
Casr T G 16: 36,510,052 M307L probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd109 TTATA TTATATATA 9: 78,712,531 probably benign Het
Cd22 A G 7: 30,876,024 S198P probably benign Het
Cd37 C A 7: 45,237,198 V99L probably benign Het
Cdkn1c A G 7: 143,460,227 S161P possibly damaging Het
Chil1 G T 1: 134,184,181 probably null Het
Col4a2 T C 8: 11,448,198 F1669S probably damaging Het
Dchs2 A T 3: 83,354,186 H2587L probably benign Het
Ddx19a A T 8: 110,983,596 M124K probably benign Het
Dnhd1 A T 7: 105,692,726 H1244L possibly damaging Het
Dnpep G A 1: 75,315,685 P165L probably damaging Het
Dpp3 T C 19: 4,923,144 R141G probably benign Het
Dpysl3 T C 18: 43,329,749 D521G probably damaging Het
Dusp4 T A 8: 34,817,191 M220K probably damaging Het
Edc4 T A 8: 105,887,201 L391Q probably damaging Het
Edrf1 A C 7: 133,671,478 I1221L probably benign Het
Elavl2 A G 4: 91,311,610 L12P probably benign Het
Fastkd3 T A 13: 68,584,952 V464D probably damaging Het
Flt4 C A 11: 49,636,771 N920K probably benign Het
Gimap3 T C 6: 48,765,325 T224A probably benign Het
Gm11236 A G 4: 73,638,948 N6S possibly damaging Het
Gm4981 G A 10: 58,235,889 P168S probably damaging Het
Gm9772 T A 17: 22,006,584 K112* probably null Het
Gp5 C A 16: 30,309,158 V233L Het
Gpr25 A T 1: 136,260,288 W196R probably benign Het
Hs3st4 G A 7: 123,983,457 G93S probably damaging Het
Igsf10 A G 3: 59,329,247 L1171S probably benign Het
Itgb7 C T 15: 102,217,924 G526S possibly damaging Het
Kcnh8 G A 17: 52,834,614 C295Y probably damaging Het
Klhl8 A G 5: 103,867,843 probably null Het
Lamp5 G T 2: 136,069,134 M262I probably benign Het
Lrp5 G T 19: 3,630,156 R443S possibly damaging Het
Lrrc66 G T 5: 73,607,924 A592E probably benign Het
Lrrc66 C T 5: 73,607,925 A592T probably benign Het
Mettl23 T A 11: 116,854,039 V93D unknown Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mkrn2os G A 6: 115,585,364 R213W probably benign Het
Mrps36 T A 13: 100,741,207 I22L probably damaging Het
Myocd T C 11: 65,186,969 R667G probably benign Het
Ncapg T A 5: 45,695,798 L869M probably damaging Het
Ndst3 T C 3: 123,671,900 N141S probably benign Het
Neu2 A T 1: 87,597,243 R317* probably null Het
Nf1 G T 11: 79,473,342 V1533F probably damaging Het
Npy4r T A 14: 34,147,126 R68S possibly damaging Het
Nr1h5 T C 3: 102,946,111 H360R probably null Het
Olfr1315-ps1 T C 2: 112,111,096 D52G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1411 T C 1: 92,597,256 S246P probably damaging Het
Osmr A C 15: 6,852,546 V39G probably damaging Het
Plekhm2 T C 4: 141,632,421 D345G possibly damaging Het
Prkaa2 G T 4: 105,049,403 S165* probably null Het
Qser1 A T 2: 104,762,947 F1575Y possibly damaging Het
Rasl11a C A 5: 146,845,297 D27E probably benign Het
Ret A T 6: 118,165,927 Y929* probably null Het
Samd9l T A 6: 3,373,493 E1256V probably benign Het
Scnn1g A G 7: 121,742,343 I243V possibly damaging Het
Slc6a3 C T 13: 73,569,912 R514* probably null Het
Sorcs3 C T 19: 48,206,370 A64V probably benign Het
Sos1 G T 17: 80,408,294 N1011K probably benign Het
Srbd1 C A 17: 86,120,687 A373S possibly damaging Het
Tas1r1 C T 4: 152,038,376 W4* probably null Het
Tcf15 C T 2: 152,143,770 R49C probably damaging Het
Tex30 A G 1: 44,087,976 V124A possibly damaging Het
Tgif1 T C 17: 70,844,887 D243G Het
Tgtp1 T G 11: 48,987,089 D263A probably damaging Het
Themis3 T A 17: 66,555,869 T365S probably benign Het
Tprg A T 16: 25,412,912 I213F probably damaging Het
Traf4 A T 11: 78,161,179 C160S probably damaging Het
Trio T C 15: 27,732,684 E3037G possibly damaging Het
Ttbk2 G T 2: 120,745,430 S1022* probably null Het
Ttc6 T C 12: 57,737,163 Y1803H probably damaging Het
Ttn A C 2: 76,719,108 Y31742D probably benign Het
Ttn G T 2: 76,787,251 P16292Q probably damaging Het
Ubr5 A G 15: 38,002,259 V1510A Het
Vac14 A G 8: 110,653,237 D389G probably benign Het
Vwa8 A G 14: 79,086,710 D1151G probably benign Het
Zfp608 T C 18: 54,899,194 N558S probably damaging Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9230:Krt2 UTSW 15 101817513 missense probably benign 0.39
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGAGGCTCTGATTGACAG -3'
(R):5'- TGAGTTGCCAGATCTCCTGC -3'

Sequencing Primer
(F):5'- TTGACAGACACTTCATGGATACCTC -3'
(R):5'- ATCTCCTGCAGGTCCCGAAG -3'
Posted On 2021-11-19