Incidental Mutation 'R9051:Kcnh8'
ID 688410
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, C130090D05Rik, Kv12.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9051 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 52602709-52979194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52834614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 295 (C295Y)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: C295Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: C295Y

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,335,232 T3289S probably damaging Het
Actr1b G T 1: 36,701,453 Q240K probably benign Het
Adamts19 T C 18: 58,900,976 V341A probably damaging Het
Akirin2 C A 4: 34,551,148 S35* probably null Het
Alg3 G T 16: 20,609,015 Q90K probably benign Het
Alox12 C T 11: 70,247,327 R394H possibly damaging Het
Ankrd17 A C 5: 90,263,275 M1387R probably damaging Het
Anp32b T G 4: 46,468,592 F121V possibly damaging Het
Atp2b2 A G 6: 113,763,605 V815A probably damaging Het
Atxn7l1 T C 12: 33,367,421 L527S probably benign Het
B9d2 C T 7: 25,686,037 L91F possibly damaging Het
BC005561 C A 5: 104,518,952 P447T probably benign Het
Bcl2l11 T A 2: 128,158,301 I188N probably damaging Het
Bnc2 A C 4: 84,291,901 S744A probably benign Het
Casr T G 16: 36,510,052 M307L probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd109 TTATA TTATATATA 9: 78,712,531 probably benign Het
Cd22 A G 7: 30,876,024 S198P probably benign Het
Cd37 C A 7: 45,237,198 V99L probably benign Het
Cdkn1c A G 7: 143,460,227 S161P possibly damaging Het
Chil1 G T 1: 134,184,181 probably null Het
Col4a2 T C 8: 11,448,198 F1669S probably damaging Het
Dchs2 A T 3: 83,354,186 H2587L probably benign Het
Ddx19a A T 8: 110,983,596 M124K probably benign Het
Dnhd1 A T 7: 105,692,726 H1244L possibly damaging Het
Dnpep G A 1: 75,315,685 P165L probably damaging Het
Dpp3 T C 19: 4,923,144 R141G probably benign Het
Dpysl3 T C 18: 43,329,749 D521G probably damaging Het
Dusp4 T A 8: 34,817,191 M220K probably damaging Het
Edc4 T A 8: 105,887,201 L391Q probably damaging Het
Edrf1 A C 7: 133,671,478 I1221L probably benign Het
Elavl2 A G 4: 91,311,610 L12P probably benign Het
Fastkd3 T A 13: 68,584,952 V464D probably damaging Het
Flt4 C A 11: 49,636,771 N920K probably benign Het
Gimap3 T C 6: 48,765,325 T224A probably benign Het
Gm11236 A G 4: 73,638,948 N6S possibly damaging Het
Gm4981 G A 10: 58,235,889 P168S probably damaging Het
Gm9772 T A 17: 22,006,584 K112* probably null Het
Gp5 C A 16: 30,309,158 V233L Het
Gpr25 A T 1: 136,260,288 W196R probably benign Het
Hs3st4 G A 7: 123,983,457 G93S probably damaging Het
Igsf10 A G 3: 59,329,247 L1171S probably benign Het
Itgb7 C T 15: 102,217,924 G526S possibly damaging Het
Klhl8 A G 5: 103,867,843 probably null Het
Krt2 T A 15: 101,817,882 I74F unknown Het
Lamp5 G T 2: 136,069,134 M262I probably benign Het
Lrp5 G T 19: 3,630,156 R443S possibly damaging Het
Lrrc66 G T 5: 73,607,924 A592E probably benign Het
Lrrc66 C T 5: 73,607,925 A592T probably benign Het
Mettl23 T A 11: 116,854,039 V93D unknown Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mkrn2os G A 6: 115,585,364 R213W probably benign Het
Mrps36 T A 13: 100,741,207 I22L probably damaging Het
Myocd T C 11: 65,186,969 R667G probably benign Het
Ncapg T A 5: 45,695,798 L869M probably damaging Het
Ndst3 T C 3: 123,671,900 N141S probably benign Het
Neu2 A T 1: 87,597,243 R317* probably null Het
Nf1 G T 11: 79,473,342 V1533F probably damaging Het
Npy4r T A 14: 34,147,126 R68S possibly damaging Het
Nr1h5 T C 3: 102,946,111 H360R probably null Het
Olfr1315-ps1 T C 2: 112,111,096 D52G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1411 T C 1: 92,597,256 S246P probably damaging Het
Osmr A C 15: 6,852,546 V39G probably damaging Het
Plekhm2 T C 4: 141,632,421 D345G possibly damaging Het
Prkaa2 G T 4: 105,049,403 S165* probably null Het
Qser1 A T 2: 104,762,947 F1575Y possibly damaging Het
Rasl11a C A 5: 146,845,297 D27E probably benign Het
Ret A T 6: 118,165,927 Y929* probably null Het
Samd9l T A 6: 3,373,493 E1256V probably benign Het
Scnn1g A G 7: 121,742,343 I243V possibly damaging Het
Slc6a3 C T 13: 73,569,912 R514* probably null Het
Sorcs3 C T 19: 48,206,370 A64V probably benign Het
Sos1 G T 17: 80,408,294 N1011K probably benign Het
Srbd1 C A 17: 86,120,687 A373S possibly damaging Het
Tas1r1 C T 4: 152,038,376 W4* probably null Het
Tcf15 C T 2: 152,143,770 R49C probably damaging Het
Tex30 A G 1: 44,087,976 V124A possibly damaging Het
Tgif1 T C 17: 70,844,887 D243G Het
Tgtp1 T G 11: 48,987,089 D263A probably damaging Het
Themis3 T A 17: 66,555,869 T365S probably benign Het
Tprg A T 16: 25,412,912 I213F probably damaging Het
Traf4 A T 11: 78,161,179 C160S probably damaging Het
Trio T C 15: 27,732,684 E3037G possibly damaging Het
Ttbk2 G T 2: 120,745,430 S1022* probably null Het
Ttc6 T C 12: 57,737,163 Y1803H probably damaging Het
Ttn A C 2: 76,719,108 Y31742D probably benign Het
Ttn G T 2: 76,787,251 P16292Q probably damaging Het
Ubr5 A G 15: 38,002,259 V1510A Het
Vac14 A G 8: 110,653,237 D389G probably benign Het
Vwa8 A G 14: 79,086,710 D1151G probably benign Het
Zfp608 T C 18: 54,899,194 N558S probably damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
R8943:Kcnh8 UTSW 17 52797458 missense probably benign 0.00
R9211:Kcnh8 UTSW 17 52839208 missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 52978140 missense probably damaging 1.00
R9243:Kcnh8 UTSW 17 52898514 missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 52839056 missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 52878061 missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 52797545 missense probably benign 0.25
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGGGTACTAATCTGAAGCAGC -3'
(R):5'- CAAACCACAGGGAGCATTTAG -3'

Sequencing Primer
(F):5'- CTGAAGCAGCTTGAAATTACTTTTC -3'
(R):5'- GCATTTAGCAGCAAATACATGAAC -3'
Posted On 2021-11-19