Incidental Mutation 'R9052:Myo3b'
ID688428
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R9052 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70232403 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 344 (M344V)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: M344V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: M344V

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: M316V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: M316V

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,948,966 E71G probably damaging Het
2610021A01Rik G T 7: 41,626,025 G384V probably benign Het
4931406B18Rik T A 7: 43,498,207 R247* probably null Het
Abca4 G T 3: 122,147,259 V1576F possibly damaging Het
Acsl6 A T 11: 54,341,789 T489S possibly damaging Het
Adcy8 C T 15: 64,920,915 R64H probably benign Het
Atad2b C A 12: 4,965,982 F569L probably damaging Het
Atp2c1 A T 9: 105,452,833 I266N probably damaging Het
Atp8a1 A G 5: 67,778,958 probably null Het
Coch T C 12: 51,593,625 M1T probably null Het
Col5a3 C A 9: 20,799,437 R537L unknown Het
Crb1 C T 1: 139,243,423 R743Q possibly damaging Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Cyp4f15 C T 17: 32,692,615 T157I probably damaging Het
D630045J12Rik G T 6: 38,177,609 Q1212K probably damaging Het
Ddx58 C A 4: 40,208,459 V826L probably benign Het
Dennd1a A G 2: 38,021,451 Y175H probably damaging Het
Dhcr7 C A 7: 143,841,323 T192K possibly damaging Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dmpk G A 7: 19,087,689 V291M probably damaging Het
Dnajc6 T C 4: 101,639,420 V928A probably damaging Het
Dst A G 1: 34,166,964 Y859C probably damaging Het
Dst C T 1: 34,197,330 Q1592* probably null Het
Fam46c A T 3: 100,473,302 I46K probably benign Het
Gm10226 T A 17: 21,692,052 C65S possibly damaging Het
Helz2 T C 2: 181,240,175 K275R possibly damaging Het
Hltf A G 3: 20,098,082 T581A probably damaging Het
Ighv1-24 C T 12: 114,772,935 C115Y probably damaging Het
Il18 C T 9: 50,577,790 L40F possibly damaging Het
Isg20 A G 7: 78,916,642 D113G probably damaging Het
Itgb3 A T 11: 104,633,587 D183V probably damaging Het
Kif12 C T 4: 63,171,831 V28M probably damaging Het
Lmtk3 T C 7: 45,800,939 F1409S unknown Het
Manbal T C 2: 157,379,187 L28P probably damaging Het
Masp1 T A 16: 23,520,600 probably benign Het
Mfap5 A G 6: 122,524,504 T72A probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a1 T A 19: 11,256,590 T101S probably benign Het
Naaladl1 T G 19: 6,108,686 F283V probably benign Het
Nacc1 A C 8: 84,676,748 V166G probably damaging Het
Nwd2 A T 5: 63,804,430 R452S probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr180 T C 16: 58,916,198 T148A probably benign Het
Olfr353 T C 2: 36,890,093 T252A probably damaging Het
Olfr807 C G 10: 129,755,225 C75S possibly damaging Het
Pik3cg T C 12: 32,195,709 I847V possibly damaging Het
Plcz1 G A 6: 140,023,179 H178Y probably damaging Het
Prkdc T A 16: 15,690,296 M937K probably benign Het
Prr14l A T 5: 32,830,134 C672* probably null Het
Rasl11a C A 5: 146,845,297 D27E probably benign Het
Rbm27 T C 18: 42,332,828 S860P probably damaging Het
Rhbdf2 A C 11: 116,603,932 L306R probably benign Het
Rnf123 A T 9: 108,059,731 V875E probably damaging Het
Slc7a9 A G 7: 35,453,592 K145R probably benign Het
Slco5a1 A T 1: 12,990,173 V108E possibly damaging Het
Stat2 A G 10: 128,281,669 E352G probably damaging Het
Synj1 A T 16: 90,938,840 S1408R probably benign Het
Tgs1 T A 4: 3,585,166 M102K probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Ttc23 C A 7: 67,692,939 C268* probably null Het
Uhrf2 T C 19: 30,092,836 F795S probably damaging Het
Urgcp A G 11: 5,723,153 W41R probably damaging Het
Uso1 G T 5: 92,180,563 V340F probably damaging Het
Vta1 A C 10: 14,675,948 I169R probably benign Het
Zfp317 A G 9: 19,645,272 I59V probably benign Het
Zfp799 G A 17: 32,820,812 T160I probably benign Het
Zfp955a G T 17: 33,242,305 H284Q possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGAGCTTAAGACTCCCCTTC -3'
(R):5'- CACCTGTGTGAAGCTCTCCATG -3'

Sequencing Primer
(F):5'- AAGACTCCCCTTCCCCTGG -3'
(R):5'- TCCATGAGAGCTGTCTACTAAGC -3'
Posted On2021-11-19