Incidental Mutation 'R9052:Myo3b'
ID 688428
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70062747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 344 (M344V)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: M344V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: M344V

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: M316V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: M316V

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,778,031 (GRCm39) E71G probably damaging Het
2610021A01Rik G T 7: 41,275,449 (GRCm39) G384V probably benign Het
4931406B18Rik T A 7: 43,147,631 (GRCm39) R247* probably null Het
Abca4 G T 3: 121,940,908 (GRCm39) V1576F possibly damaging Het
Acsl6 A T 11: 54,232,615 (GRCm39) T489S possibly damaging Het
Adcy8 C T 15: 64,792,764 (GRCm39) R64H probably benign Het
Atad2b C A 12: 5,015,982 (GRCm39) F569L probably damaging Het
Atp2c1 A T 9: 105,330,032 (GRCm39) I266N probably damaging Het
Atp8a1 A G 5: 67,936,301 (GRCm39) probably null Het
Coch T C 12: 51,640,408 (GRCm39) M1T probably null Het
Col5a3 C A 9: 20,710,733 (GRCm39) R537L unknown Het
Crb1 C T 1: 139,171,161 (GRCm39) R743Q possibly damaging Het
Crybg2 T C 4: 133,803,035 (GRCm39) F889L probably damaging Het
Cyp4f15 C T 17: 32,911,589 (GRCm39) T157I probably damaging Het
D630045J12Rik G T 6: 38,154,544 (GRCm39) Q1212K probably damaging Het
Dennd1a A G 2: 37,911,463 (GRCm39) Y175H probably damaging Het
Dhcr7 C A 7: 143,395,060 (GRCm39) T192K possibly damaging Het
Dlg1 T A 16: 31,656,942 (GRCm39) I612N probably damaging Het
Dmpk G A 7: 18,821,614 (GRCm39) V291M probably damaging Het
Dnajc6 T C 4: 101,496,617 (GRCm39) V928A probably damaging Het
Dst A G 1: 34,206,045 (GRCm39) Y859C probably damaging Het
Dst C T 1: 34,236,411 (GRCm39) Q1592* probably null Het
Gm10226 T A 17: 21,910,959 (GRCm39) C65S possibly damaging Het
Helz2 T C 2: 180,881,968 (GRCm39) K275R possibly damaging Het
Hltf A G 3: 20,152,246 (GRCm39) T581A probably damaging Het
Ighv1-24 C T 12: 114,736,555 (GRCm39) C115Y probably damaging Het
Il18 C T 9: 50,489,090 (GRCm39) L40F possibly damaging Het
Isg20 A G 7: 78,566,390 (GRCm39) D113G probably damaging Het
Itgb3 A T 11: 104,524,413 (GRCm39) D183V probably damaging Het
Kif12 C T 4: 63,090,068 (GRCm39) V28M probably damaging Het
Manbal T C 2: 157,221,107 (GRCm39) L28P probably damaging Het
Masp1 T A 16: 23,339,350 (GRCm39) probably benign Het
Mfap5 A G 6: 122,501,463 (GRCm39) T72A probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mrps5 G A 2: 127,433,876 (GRCm39) probably benign Het
Ms4a1 T A 19: 11,233,954 (GRCm39) T101S probably benign Het
Naaladl1 T G 19: 6,158,716 (GRCm39) F283V probably benign Het
Nacc1 A C 8: 85,403,377 (GRCm39) V166G probably damaging Het
Nwd2 A T 5: 63,961,773 (GRCm39) R452S probably damaging Het
Or1n1b T C 2: 36,780,105 (GRCm39) T252A probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5k16 T C 16: 58,736,561 (GRCm39) T148A probably benign Het
Or6c214 C G 10: 129,591,094 (GRCm39) C75S possibly damaging Het
Pik3cg T C 12: 32,245,708 (GRCm39) I847V possibly damaging Het
Plcz1 G A 6: 139,968,905 (GRCm39) H178Y probably damaging Het
Prkdc T A 16: 15,508,160 (GRCm39) M937K probably benign Het
Prr14l A T 5: 32,987,478 (GRCm39) C672* probably null Het
Rasl11a C A 5: 146,782,107 (GRCm39) D27E probably benign Het
Rbm27 T C 18: 42,465,893 (GRCm39) S860P probably damaging Het
Rfxap G A 3: 54,715,155 (GRCm39) probably benign Het
Rhbdf2 A C 11: 116,494,758 (GRCm39) L306R probably benign Het
Rigi C A 4: 40,208,459 (GRCm39) V826L probably benign Het
Rnf123 A T 9: 107,936,930 (GRCm39) V875E probably damaging Het
Sh3bp2 A G 5: 34,709,164 (GRCm39) probably benign Het
Slc7a9 A G 7: 35,153,017 (GRCm39) K145R probably benign Het
Slco5a1 A T 1: 13,060,397 (GRCm39) V108E possibly damaging Het
Stat2 A G 10: 128,117,538 (GRCm39) E352G probably damaging Het
Synj1 A T 16: 90,735,728 (GRCm39) S1408R probably benign Het
Tent5c A T 3: 100,380,618 (GRCm39) I46K probably benign Het
Tgs1 T A 4: 3,585,166 (GRCm39) M102K probably benign Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Ttc23 C A 7: 67,342,687 (GRCm39) C268* probably null Het
Uhrf2 T C 19: 30,070,236 (GRCm39) F795S probably damaging Het
Urgcp A G 11: 5,673,153 (GRCm39) W41R probably damaging Het
Uso1 G T 5: 92,328,422 (GRCm39) V340F probably damaging Het
Vta1 A C 10: 14,551,692 (GRCm39) I169R probably benign Het
Zfp317 A G 9: 19,556,568 (GRCm39) I59V probably benign Het
Zfp799 G A 17: 33,039,786 (GRCm39) T160I probably benign Het
Zfp955a G T 17: 33,461,279 (GRCm39) H284Q possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGCTTAAGACTCCCCTTC -3'
(R):5'- CACCTGTGTGAAGCTCTCCATG -3'

Sequencing Primer
(F):5'- AAGACTCCCCTTCCCCTGG -3'
(R):5'- TCCATGAGAGCTGTCTACTAAGC -3'
Posted On 2021-11-19