Incidental Mutation 'R9052:Helz2'
ID 688430
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission 068878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9052 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180881968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 275 (K275R)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000094203
AA Change: K275R

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: K275R

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: K275R

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: K275R

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: K275R

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: K275R

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,778,031 (GRCm39) E71G probably damaging Het
2610021A01Rik G T 7: 41,275,449 (GRCm39) G384V probably benign Het
4931406B18Rik T A 7: 43,147,631 (GRCm39) R247* probably null Het
Abca4 G T 3: 121,940,908 (GRCm39) V1576F possibly damaging Het
Acsl6 A T 11: 54,232,615 (GRCm39) T489S possibly damaging Het
Adcy8 C T 15: 64,792,764 (GRCm39) R64H probably benign Het
Atad2b C A 12: 5,015,982 (GRCm39) F569L probably damaging Het
Atp2c1 A T 9: 105,330,032 (GRCm39) I266N probably damaging Het
Atp8a1 A G 5: 67,936,301 (GRCm39) probably null Het
Coch T C 12: 51,640,408 (GRCm39) M1T probably null Het
Col5a3 C A 9: 20,710,733 (GRCm39) R537L unknown Het
Crb1 C T 1: 139,171,161 (GRCm39) R743Q possibly damaging Het
Crybg2 T C 4: 133,803,035 (GRCm39) F889L probably damaging Het
Cyp4f15 C T 17: 32,911,589 (GRCm39) T157I probably damaging Het
D630045J12Rik G T 6: 38,154,544 (GRCm39) Q1212K probably damaging Het
Dennd1a A G 2: 37,911,463 (GRCm39) Y175H probably damaging Het
Dhcr7 C A 7: 143,395,060 (GRCm39) T192K possibly damaging Het
Dlg1 T A 16: 31,656,942 (GRCm39) I612N probably damaging Het
Dmpk G A 7: 18,821,614 (GRCm39) V291M probably damaging Het
Dnajc6 T C 4: 101,496,617 (GRCm39) V928A probably damaging Het
Dst A G 1: 34,206,045 (GRCm39) Y859C probably damaging Het
Dst C T 1: 34,236,411 (GRCm39) Q1592* probably null Het
Gm10226 T A 17: 21,910,959 (GRCm39) C65S possibly damaging Het
Hltf A G 3: 20,152,246 (GRCm39) T581A probably damaging Het
Ighv1-24 C T 12: 114,736,555 (GRCm39) C115Y probably damaging Het
Il18 C T 9: 50,489,090 (GRCm39) L40F possibly damaging Het
Isg20 A G 7: 78,566,390 (GRCm39) D113G probably damaging Het
Itgb3 A T 11: 104,524,413 (GRCm39) D183V probably damaging Het
Kif12 C T 4: 63,090,068 (GRCm39) V28M probably damaging Het
Manbal T C 2: 157,221,107 (GRCm39) L28P probably damaging Het
Masp1 T A 16: 23,339,350 (GRCm39) probably benign Het
Mfap5 A G 6: 122,501,463 (GRCm39) T72A probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mrps5 G A 2: 127,433,876 (GRCm39) probably benign Het
Ms4a1 T A 19: 11,233,954 (GRCm39) T101S probably benign Het
Myo3b A G 2: 70,062,747 (GRCm39) M344V probably benign Het
Naaladl1 T G 19: 6,158,716 (GRCm39) F283V probably benign Het
Nacc1 A C 8: 85,403,377 (GRCm39) V166G probably damaging Het
Nwd2 A T 5: 63,961,773 (GRCm39) R452S probably damaging Het
Or1n1b T C 2: 36,780,105 (GRCm39) T252A probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5k16 T C 16: 58,736,561 (GRCm39) T148A probably benign Het
Or6c214 C G 10: 129,591,094 (GRCm39) C75S possibly damaging Het
Pik3cg T C 12: 32,245,708 (GRCm39) I847V possibly damaging Het
Plcz1 G A 6: 139,968,905 (GRCm39) H178Y probably damaging Het
Prkdc T A 16: 15,508,160 (GRCm39) M937K probably benign Het
Prr14l A T 5: 32,987,478 (GRCm39) C672* probably null Het
Rasl11a C A 5: 146,782,107 (GRCm39) D27E probably benign Het
Rbm27 T C 18: 42,465,893 (GRCm39) S860P probably damaging Het
Rfxap G A 3: 54,715,155 (GRCm39) probably benign Het
Rhbdf2 A C 11: 116,494,758 (GRCm39) L306R probably benign Het
Rigi C A 4: 40,208,459 (GRCm39) V826L probably benign Het
Rnf123 A T 9: 107,936,930 (GRCm39) V875E probably damaging Het
Sh3bp2 A G 5: 34,709,164 (GRCm39) probably benign Het
Slc7a9 A G 7: 35,153,017 (GRCm39) K145R probably benign Het
Slco5a1 A T 1: 13,060,397 (GRCm39) V108E possibly damaging Het
Stat2 A G 10: 128,117,538 (GRCm39) E352G probably damaging Het
Synj1 A T 16: 90,735,728 (GRCm39) S1408R probably benign Het
Tent5c A T 3: 100,380,618 (GRCm39) I46K probably benign Het
Tgs1 T A 4: 3,585,166 (GRCm39) M102K probably benign Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Ttc23 C A 7: 67,342,687 (GRCm39) C268* probably null Het
Uhrf2 T C 19: 30,070,236 (GRCm39) F795S probably damaging Het
Urgcp A G 11: 5,673,153 (GRCm39) W41R probably damaging Het
Uso1 G T 5: 92,328,422 (GRCm39) V340F probably damaging Het
Vta1 A C 10: 14,551,692 (GRCm39) I169R probably benign Het
Zfp317 A G 9: 19,556,568 (GRCm39) I59V probably benign Het
Zfp799 G A 17: 33,039,786 (GRCm39) T160I probably benign Het
Zfp955a G T 17: 33,461,279 (GRCm39) H284Q possibly damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAGAGTCCCATTGGTG -3'
(R):5'- GAGGGCCTAAAGCGACAATTC -3'

Sequencing Primer
(F):5'- GGGGCACGGTGTTTCCAG -3'
(R):5'- CGACAATTCGTGGAGGTGC -3'
Posted On 2021-11-19