Incidental Mutation 'R9052:Prr14l'
ID 688439
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R9052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 32830134 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 672 (C672*)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably null
Transcript: ENSMUST00000120129
AA Change: C672*
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: C672*

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,948,966 E71G probably damaging Het
2610021A01Rik G T 7: 41,626,025 G384V probably benign Het
4931406B18Rik T A 7: 43,498,207 R247* probably null Het
Abca4 G T 3: 122,147,259 V1576F possibly damaging Het
Acsl6 A T 11: 54,341,789 T489S possibly damaging Het
Adcy8 C T 15: 64,920,915 R64H probably benign Het
Atad2b C A 12: 4,965,982 F569L probably damaging Het
Atp2c1 A T 9: 105,452,833 I266N probably damaging Het
Atp8a1 A G 5: 67,778,958 probably null Het
Coch T C 12: 51,593,625 M1T probably null Het
Col5a3 C A 9: 20,799,437 R537L unknown Het
Crb1 C T 1: 139,243,423 R743Q possibly damaging Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Cyp4f15 C T 17: 32,692,615 T157I probably damaging Het
D630045J12Rik G T 6: 38,177,609 Q1212K probably damaging Het
Ddx58 C A 4: 40,208,459 V826L probably benign Het
Dennd1a A G 2: 38,021,451 Y175H probably damaging Het
Dhcr7 C A 7: 143,841,323 T192K possibly damaging Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dmpk G A 7: 19,087,689 V291M probably damaging Het
Dnajc6 T C 4: 101,639,420 V928A probably damaging Het
Dst A G 1: 34,166,964 Y859C probably damaging Het
Dst C T 1: 34,197,330 Q1592* probably null Het
Fam46c A T 3: 100,473,302 I46K probably benign Het
Gm10226 T A 17: 21,692,052 C65S possibly damaging Het
Helz2 T C 2: 181,240,175 K275R possibly damaging Het
Hltf A G 3: 20,098,082 T581A probably damaging Het
Ighv1-24 C T 12: 114,772,935 C115Y probably damaging Het
Il18 C T 9: 50,577,790 L40F possibly damaging Het
Isg20 A G 7: 78,916,642 D113G probably damaging Het
Itgb3 A T 11: 104,633,587 D183V probably damaging Het
Kif12 C T 4: 63,171,831 V28M probably damaging Het
Lmtk3 T C 7: 45,800,939 F1409S unknown Het
Manbal T C 2: 157,379,187 L28P probably damaging Het
Masp1 T A 16: 23,520,600 probably benign Het
Mfap5 A G 6: 122,524,504 T72A probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a1 T A 19: 11,256,590 T101S probably benign Het
Myo3b A G 2: 70,232,403 M344V probably benign Het
Naaladl1 T G 19: 6,108,686 F283V probably benign Het
Nacc1 A C 8: 84,676,748 V166G probably damaging Het
Nwd2 A T 5: 63,804,430 R452S probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr180 T C 16: 58,916,198 T148A probably benign Het
Olfr353 T C 2: 36,890,093 T252A probably damaging Het
Olfr807 C G 10: 129,755,225 C75S possibly damaging Het
Pik3cg T C 12: 32,195,709 I847V possibly damaging Het
Plcz1 G A 6: 140,023,179 H178Y probably damaging Het
Prkdc T A 16: 15,690,296 M937K probably benign Het
Rasl11a C A 5: 146,845,297 D27E probably benign Het
Rbm27 T C 18: 42,332,828 S860P probably damaging Het
Rhbdf2 A C 11: 116,603,932 L306R probably benign Het
Rnf123 A T 9: 108,059,731 V875E probably damaging Het
Slc7a9 A G 7: 35,453,592 K145R probably benign Het
Slco5a1 A T 1: 12,990,173 V108E possibly damaging Het
Stat2 A G 10: 128,281,669 E352G probably damaging Het
Synj1 A T 16: 90,938,840 S1408R probably benign Het
Tgs1 T A 4: 3,585,166 M102K probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Ttc23 C A 7: 67,692,939 C268* probably null Het
Uhrf2 T C 19: 30,092,836 F795S probably damaging Het
Urgcp A G 11: 5,723,153 W41R probably damaging Het
Uso1 G T 5: 92,180,563 V340F probably damaging Het
Vta1 A C 10: 14,675,948 I169R probably benign Het
Zfp317 A G 9: 19,645,272 I59V probably benign Het
Zfp799 G A 17: 32,820,812 T160I probably benign Het
Zfp955a G T 17: 33,242,305 H284Q possibly damaging Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- ACCAGTTTCCATGTGAGTGGC -3'
(R):5'- GACTGCTGTACATTCCACGTTC -3'

Sequencing Primer
(F):5'- TGTTCAGAGAAGCAGTATGTGTCAC -3'
(R):5'- GTACATTCCACGTTCTTCTCAAGTG -3'
Posted On 2021-11-19