Incidental Mutation 'R9052:Dhcr7'
ID 688454
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 068878-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9052 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 143395060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 192 (T192K)
Ref Sequence ENSEMBL: ENSMUSP00000146947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000144034] [ENSMUST00000145471]
AlphaFold O88455
Predicted Effect possibly damaging
Transcript: ENSMUST00000073878
AA Change: T189K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: T189K

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124340
AA Change: T189K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: T189K

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect possibly damaging
Transcript: ENSMUST00000141916
AA Change: T189K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: T189K

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143338
AA Change: T189K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: T189K

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207143
AA Change: T192K

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,778,031 (GRCm39) E71G probably damaging Het
2610021A01Rik G T 7: 41,275,449 (GRCm39) G384V probably benign Het
4931406B18Rik T A 7: 43,147,631 (GRCm39) R247* probably null Het
Abca4 G T 3: 121,940,908 (GRCm39) V1576F possibly damaging Het
Acsl6 A T 11: 54,232,615 (GRCm39) T489S possibly damaging Het
Adcy8 C T 15: 64,792,764 (GRCm39) R64H probably benign Het
Atad2b C A 12: 5,015,982 (GRCm39) F569L probably damaging Het
Atp2c1 A T 9: 105,330,032 (GRCm39) I266N probably damaging Het
Atp8a1 A G 5: 67,936,301 (GRCm39) probably null Het
Coch T C 12: 51,640,408 (GRCm39) M1T probably null Het
Col5a3 C A 9: 20,710,733 (GRCm39) R537L unknown Het
Crb1 C T 1: 139,171,161 (GRCm39) R743Q possibly damaging Het
Crybg2 T C 4: 133,803,035 (GRCm39) F889L probably damaging Het
Cyp4f15 C T 17: 32,911,589 (GRCm39) T157I probably damaging Het
D630045J12Rik G T 6: 38,154,544 (GRCm39) Q1212K probably damaging Het
Dennd1a A G 2: 37,911,463 (GRCm39) Y175H probably damaging Het
Dlg1 T A 16: 31,656,942 (GRCm39) I612N probably damaging Het
Dmpk G A 7: 18,821,614 (GRCm39) V291M probably damaging Het
Dnajc6 T C 4: 101,496,617 (GRCm39) V928A probably damaging Het
Dst A G 1: 34,206,045 (GRCm39) Y859C probably damaging Het
Dst C T 1: 34,236,411 (GRCm39) Q1592* probably null Het
Gm10226 T A 17: 21,910,959 (GRCm39) C65S possibly damaging Het
Helz2 T C 2: 180,881,968 (GRCm39) K275R possibly damaging Het
Hltf A G 3: 20,152,246 (GRCm39) T581A probably damaging Het
Ighv1-24 C T 12: 114,736,555 (GRCm39) C115Y probably damaging Het
Il18 C T 9: 50,489,090 (GRCm39) L40F possibly damaging Het
Isg20 A G 7: 78,566,390 (GRCm39) D113G probably damaging Het
Itgb3 A T 11: 104,524,413 (GRCm39) D183V probably damaging Het
Kif12 C T 4: 63,090,068 (GRCm39) V28M probably damaging Het
Manbal T C 2: 157,221,107 (GRCm39) L28P probably damaging Het
Masp1 T A 16: 23,339,350 (GRCm39) probably benign Het
Mfap5 A G 6: 122,501,463 (GRCm39) T72A probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mrps5 G A 2: 127,433,876 (GRCm39) probably benign Het
Ms4a1 T A 19: 11,233,954 (GRCm39) T101S probably benign Het
Myo3b A G 2: 70,062,747 (GRCm39) M344V probably benign Het
Naaladl1 T G 19: 6,158,716 (GRCm39) F283V probably benign Het
Nacc1 A C 8: 85,403,377 (GRCm39) V166G probably damaging Het
Nwd2 A T 5: 63,961,773 (GRCm39) R452S probably damaging Het
Or1n1b T C 2: 36,780,105 (GRCm39) T252A probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5k16 T C 16: 58,736,561 (GRCm39) T148A probably benign Het
Or6c214 C G 10: 129,591,094 (GRCm39) C75S possibly damaging Het
Pik3cg T C 12: 32,245,708 (GRCm39) I847V possibly damaging Het
Plcz1 G A 6: 139,968,905 (GRCm39) H178Y probably damaging Het
Prkdc T A 16: 15,508,160 (GRCm39) M937K probably benign Het
Prr14l A T 5: 32,987,478 (GRCm39) C672* probably null Het
Rasl11a C A 5: 146,782,107 (GRCm39) D27E probably benign Het
Rbm27 T C 18: 42,465,893 (GRCm39) S860P probably damaging Het
Rfxap G A 3: 54,715,155 (GRCm39) probably benign Het
Rhbdf2 A C 11: 116,494,758 (GRCm39) L306R probably benign Het
Rigi C A 4: 40,208,459 (GRCm39) V826L probably benign Het
Rnf123 A T 9: 107,936,930 (GRCm39) V875E probably damaging Het
Sh3bp2 A G 5: 34,709,164 (GRCm39) probably benign Het
Slc7a9 A G 7: 35,153,017 (GRCm39) K145R probably benign Het
Slco5a1 A T 1: 13,060,397 (GRCm39) V108E possibly damaging Het
Stat2 A G 10: 128,117,538 (GRCm39) E352G probably damaging Het
Synj1 A T 16: 90,735,728 (GRCm39) S1408R probably benign Het
Tent5c A T 3: 100,380,618 (GRCm39) I46K probably benign Het
Tgs1 T A 4: 3,585,166 (GRCm39) M102K probably benign Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Ttc23 C A 7: 67,342,687 (GRCm39) C268* probably null Het
Uhrf2 T C 19: 30,070,236 (GRCm39) F795S probably damaging Het
Urgcp A G 11: 5,673,153 (GRCm39) W41R probably damaging Het
Uso1 G T 5: 92,328,422 (GRCm39) V340F probably damaging Het
Vta1 A C 10: 14,551,692 (GRCm39) I169R probably benign Het
Zfp317 A G 9: 19,556,568 (GRCm39) I59V probably benign Het
Zfp799 G A 17: 33,039,786 (GRCm39) T160I probably benign Het
Zfp955a G T 17: 33,461,279 (GRCm39) H284Q possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATCCAACCAGAGTTCTCTG -3'
(R):5'- GCTACCGCTAGCAGTTCTTC -3'

Sequencing Primer
(F):5'- AACCAGAGTTCTCTGTCTGATTG -3'
(R):5'- GCTAGCAGTTCTTCAAGCAAG -3'
Posted On 2021-11-19