Mutagenetix > Incidental Mutation

Incidental Mutation 'R9052:Rnf123'

688460

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

068878-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R9052 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108059731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 875 (V875E)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000085060] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: V875E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: V875E

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085060

SMART Domains

Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	33	65	2.55e-2	SMART
LRR	65	83	6.97e1	SMART
LRR_TYP	84	107	1.56e-2	SMART
LRR	109	131	2.84e1	SMART
LRR	132	155	7.05e-1	SMART
LRR	156	176	3.98e1	SMART
LRR	182	206	5.56e0	SMART
Blast:LRRCT	219	274	8e-23	BLAST
IG	285	372	1.59e-6	SMART
transmembrane domain	383	405	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: V869E

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: V869E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: V869E

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: V875E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: V875E

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162753
AA Change: V12E

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: V869E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: V869E

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059G10Rik	T	C	9: 122,948,966	E71G	probably damaging	Het
2610021A01Rik	G	T	7: 41,626,025	G384V	probably benign	Het
4931406B18Rik	T	A	7: 43,498,207	R247*	probably null	Het
Abca4	G	T	3: 122,147,259	V1576F	possibly damaging	Het
Acsl6	A	T	11: 54,341,789	T489S	possibly damaging	Het
Adcy8	C	T	15: 64,920,915	R64H	probably benign	Het
Atad2b	C	A	12: 4,965,982	F569L	probably damaging	Het
Atp2c1	A	T	9: 105,452,833	I266N	probably damaging	Het
Atp8a1	A	G	5: 67,778,958		probably null	Het
Coch	T	C	12: 51,593,625	M1T	probably null	Het
Col5a3	C	A	9: 20,799,437	R537L	unknown	Het
Crb1	C	T	1: 139,243,423	R743Q	possibly damaging	Het
Crybg2	T	C	4: 134,075,724	F889L	probably damaging	Het
Cyp4f15	C	T	17: 32,692,615	T157I	probably damaging	Het
D630045J12Rik	G	T	6: 38,177,609	Q1212K	probably damaging	Het
Ddx58	C	A	4: 40,208,459	V826L	probably benign	Het
Dennd1a	A	G	2: 38,021,451	Y175H	probably damaging	Het
Dhcr7	C	A	7: 143,841,323	T192K	possibly damaging	Het
Dlg1	T	A	16: 31,838,124	I612N	probably damaging	Het
Dmpk	G	A	7: 19,087,689	V291M	probably damaging	Het
Dnajc6	T	C	4: 101,639,420	V928A	probably damaging	Het
Dst	A	G	1: 34,166,964	Y859C	probably damaging	Het
Dst	C	T	1: 34,197,330	Q1592*	probably null	Het
Fam46c	A	T	3: 100,473,302	I46K	probably benign	Het
Gm10226	T	A	17: 21,692,052	C65S	possibly damaging	Het
Helz2	T	C	2: 181,240,175	K275R	possibly damaging	Het
Hltf	A	G	3: 20,098,082	T581A	probably damaging	Het
Ighv1-24	C	T	12: 114,772,935	C115Y	probably damaging	Het
Il18	C	T	9: 50,577,790	L40F	possibly damaging	Het
Isg20	A	G	7: 78,916,642	D113G	probably damaging	Het
Itgb3	A	T	11: 104,633,587	D183V	probably damaging	Het
Kif12	C	T	4: 63,171,831	V28M	probably damaging	Het
Manbal	T	C	2: 157,379,187	L28P	probably damaging	Het
Masp1	T	A	16: 23,520,600		probably benign	Het
Mfap5	A	G	6: 122,524,504	T72A	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mrps5	G	A	2: 127,591,956		probably benign	Het
Ms4a1	T	A	19: 11,256,590	T101S	probably benign	Het
Myo3b	A	G	2: 70,232,403	M344V	probably benign	Het
Naaladl1	T	G	19: 6,108,686	F283V	probably benign	Het
Nacc1	A	C	8: 84,676,748	V166G	probably damaging	Het
Nwd2	A	T	5: 63,804,430	R452S	probably damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr180	T	C	16: 58,916,198	T148A	probably benign	Het
Olfr353	T	C	2: 36,890,093	T252A	probably damaging	Het
Olfr807	C	G	10: 129,755,225	C75S	possibly damaging	Het
Pik3cg	T	C	12: 32,195,709	I847V	possibly damaging	Het
Plcz1	G	A	6: 140,023,179	H178Y	probably damaging	Het
Prkdc	T	A	16: 15,690,296	M937K	probably benign	Het
Prr14l	A	T	5: 32,830,134	C672*	probably null	Het
Rasl11a	C	A	5: 146,845,297	D27E	probably benign	Het
Rbm27	T	C	18: 42,332,828	S860P	probably damaging	Het
Rfxap	G	A	3: 54,807,734		probably benign	Het
Rhbdf2	A	C	11: 116,603,932	L306R	probably benign	Het
Sh3bp2	A	G	5: 34,551,820		probably benign	Het
Slc7a9	A	G	7: 35,453,592	K145R	probably benign	Het
Slco5a1	A	T	1: 12,990,173	V108E	possibly damaging	Het
Stat2	A	G	10: 128,281,669	E352G	probably damaging	Het
Synj1	A	T	16: 90,938,840	S1408R	probably benign	Het
Tgs1	T	A	4: 3,585,166	M102K	probably benign	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Ttc23	C	A	7: 67,692,939	C268*	probably null	Het
Uhrf2	T	C	19: 30,092,836	F795S	probably damaging	Het
Urgcp	A	G	11: 5,723,153	W41R	probably damaging	Het
Uso1	G	T	5: 92,180,563	V340F	probably damaging	Het
Vta1	A	C	10: 14,675,948	I169R	probably benign	Het
Zfp317	A	G	9: 19,645,272	I59V	probably benign	Het
Zfp799	G	A	17: 32,820,812	T160I	probably benign	Het
Zfp955a	G	T	17: 33,242,305	H284Q	possibly damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGGCACTAATTCAGTACAAAAG -3'
(R):5'- TAGGCCTTTCTGCACCCTAG -3'

Sequencing Primer
(F):5'- CAGTACAAAAGTTTAATGTGTGTGTG -3'
(R):5'- TTCTGCACCCTAGGCCAG -3'

Posted On

2021-11-19