Incidental Mutation 'R9052:Atad2b'
ID 688471
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9052 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 4965982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 569 (F569L)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: F569L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: F569L

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T C 9: 122,948,966 E71G probably damaging Het
2610021A01Rik G T 7: 41,626,025 G384V probably benign Het
4931406B18Rik T A 7: 43,498,207 R247* probably null Het
Abca4 G T 3: 122,147,259 V1576F possibly damaging Het
Acsl6 A T 11: 54,341,789 T489S possibly damaging Het
Adcy8 C T 15: 64,920,915 R64H probably benign Het
Atp2c1 A T 9: 105,452,833 I266N probably damaging Het
Atp8a1 A G 5: 67,778,958 probably null Het
Coch T C 12: 51,593,625 M1T probably null Het
Col5a3 C A 9: 20,799,437 R537L unknown Het
Crb1 C T 1: 139,243,423 R743Q possibly damaging Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Cyp4f15 C T 17: 32,692,615 T157I probably damaging Het
D630045J12Rik G T 6: 38,177,609 Q1212K probably damaging Het
Ddx58 C A 4: 40,208,459 V826L probably benign Het
Dennd1a A G 2: 38,021,451 Y175H probably damaging Het
Dhcr7 C A 7: 143,841,323 T192K possibly damaging Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dmpk G A 7: 19,087,689 V291M probably damaging Het
Dnajc6 T C 4: 101,639,420 V928A probably damaging Het
Dst A G 1: 34,166,964 Y859C probably damaging Het
Dst C T 1: 34,197,330 Q1592* probably null Het
Fam46c A T 3: 100,473,302 I46K probably benign Het
Gm10226 T A 17: 21,692,052 C65S possibly damaging Het
Helz2 T C 2: 181,240,175 K275R possibly damaging Het
Hltf A G 3: 20,098,082 T581A probably damaging Het
Ighv1-24 C T 12: 114,772,935 C115Y probably damaging Het
Il18 C T 9: 50,577,790 L40F possibly damaging Het
Isg20 A G 7: 78,916,642 D113G probably damaging Het
Itgb3 A T 11: 104,633,587 D183V probably damaging Het
Kif12 C T 4: 63,171,831 V28M probably damaging Het
Lmtk3 T C 7: 45,800,939 F1409S unknown Het
Manbal T C 2: 157,379,187 L28P probably damaging Het
Masp1 T A 16: 23,520,600 probably benign Het
Mfap5 A G 6: 122,524,504 T72A probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a1 T A 19: 11,256,590 T101S probably benign Het
Myo3b A G 2: 70,232,403 M344V probably benign Het
Naaladl1 T G 19: 6,108,686 F283V probably benign Het
Nacc1 A C 8: 84,676,748 V166G probably damaging Het
Nwd2 A T 5: 63,804,430 R452S probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr180 T C 16: 58,916,198 T148A probably benign Het
Olfr353 T C 2: 36,890,093 T252A probably damaging Het
Olfr807 C G 10: 129,755,225 C75S possibly damaging Het
Pik3cg T C 12: 32,195,709 I847V possibly damaging Het
Plcz1 G A 6: 140,023,179 H178Y probably damaging Het
Prkdc T A 16: 15,690,296 M937K probably benign Het
Prr14l A T 5: 32,830,134 C672* probably null Het
Rasl11a C A 5: 146,845,297 D27E probably benign Het
Rbm27 T C 18: 42,332,828 S860P probably damaging Het
Rhbdf2 A C 11: 116,603,932 L306R probably benign Het
Rnf123 A T 9: 108,059,731 V875E probably damaging Het
Slc7a9 A G 7: 35,453,592 K145R probably benign Het
Slco5a1 A T 1: 12,990,173 V108E possibly damaging Het
Stat2 A G 10: 128,281,669 E352G probably damaging Het
Synj1 A T 16: 90,938,840 S1408R probably benign Het
Tgs1 T A 4: 3,585,166 M102K probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Ttc23 C A 7: 67,692,939 C268* probably null Het
Uhrf2 T C 19: 30,092,836 F795S probably damaging Het
Urgcp A G 11: 5,723,153 W41R probably damaging Het
Uso1 G T 5: 92,180,563 V340F probably damaging Het
Vta1 A C 10: 14,675,948 I169R probably benign Het
Zfp317 A G 9: 19,645,272 I59V probably benign Het
Zfp799 G A 17: 32,820,812 T160I probably benign Het
Zfp955a G T 17: 33,242,305 H284Q possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAGTACTGCAACCCTCCC -3'
(R):5'- TGGCAAGGGGTATCACCTTC -3'

Sequencing Primer
(F):5'- TTTTCATTAAGTTTTGCATGGCC -3'
(R):5'- GGGGTATCACCTTCAAAGTATATGC -3'
Posted On 2021-11-19