Incidental Mutation 'R9053:Fat4'
ID 688496
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9053 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 38886940-39011985 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 38887175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 72 (Y72*)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000061260
AA Change: Y72*
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: Y72*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,689,275 L121Q probably damaging Het
4930452B06Rik T C 14: 8,518,768 probably null Het
Acat3 A G 17: 12,928,515 V205A probably damaging Het
Acp7 A G 7: 28,617,191 F120L possibly damaging Het
Adh4 T C 3: 138,422,284 V157A probably damaging Het
Ahsa2 T C 11: 23,493,314 E146G probably benign Het
Ank3 T C 10: 69,986,559 S353P Het
Apob T C 12: 8,008,954 S2479P possibly damaging Het
Arhgef37 A G 18: 61,508,689 L203P probably damaging Het
Arpp21 T A 9: 112,155,515 N265I possibly damaging Het
Dagla G A 19: 10,269,251 R162C probably damaging Het
Ddx18 T C 1: 121,561,406 D304G probably damaging Het
Dnah3 A T 7: 120,019,764 L1638Q possibly damaging Het
Dnah6 T A 6: 73,084,657 N2815I possibly damaging Het
Dnajc16 T C 4: 141,783,060 D94G probably benign Het
Epor G T 9: 21,959,359 D408E probably benign Het
Erbb4 T C 1: 68,250,620 N754S possibly damaging Het
Etaa1 A G 11: 17,945,798 I773T probably benign Het
Fam126a A G 5: 23,979,581 C300R possibly damaging Het
Fbxw18 T G 9: 109,688,423 D404A probably benign Het
Flot1 T A 17: 35,829,967 V283E probably damaging Het
Gm5145 G T 17: 20,570,932 G191W probably damaging Het
Helz C A 11: 107,672,935 Q1734K unknown Het
Ints1 A G 5: 139,762,067 V1195A possibly damaging Het
Kmt2a T A 9: 44,821,419 T2534S unknown Het
Lingo3 T C 10: 80,834,987 N370D probably benign Het
Lrp1b A G 2: 40,858,489 V3113A Het
Mthfs C T 9: 89,215,401 L104F probably damaging Het
Nlgn1 A T 3: 25,434,443 V576D probably damaging Het
Nlrc5 A G 8: 94,490,385 R1001G probably benign Het
Obscn C T 11: 59,081,810 A2137T probably benign Het
Ociad1 T A 5: 73,303,608 H70Q probably damaging Het
Olfr1249 A G 2: 89,630,817 V27A probably benign Het
Opa1 T A 16: 29,586,018 C11* probably null Het
Parp10 T C 15: 76,241,764 E408G possibly damaging Het
Pcdhb19 G A 18: 37,498,090 E313K probably benign Het
Pmel G T 10: 128,716,049 A251S probably benign Het
Polr3d G T 14: 70,440,713 P181T probably damaging Het
Prmt3 A T 7: 49,780,356 H69L probably damaging Het
Rc3h2 A T 2: 37,399,616 Y395N possibly damaging Het
Rubcnl A T 14: 75,032,277 N125I possibly damaging Het
Shprh T C 10: 11,154,702 F221S probably benign Het
Skint5 A T 4: 113,546,487 S1179R unknown Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slc44a3 T C 3: 121,527,190 Y54C probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Spag5 A T 11: 78,321,749 I1137F probably benign Het
Tchp A T 5: 114,715,855 Y277F probably benign Het
Tdrd12 A C 7: 35,505,043 L267W probably damaging Het
Tfcp2 A T 15: 100,498,211 I107N Het
Vmn1r9 T C 6: 57,071,528 V196A probably benign Het
Vmn2r62 T A 7: 42,764,496 D841V Het
Zzef1 G T 11: 72,922,476 R2901L probably benign Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
Asahi UTSW 3 38981819 missense probably damaging 1.00
Expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
schlitz UTSW 3 38980659 missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38889004 missense probably benign 0.04
PIT4696001:Fat4 UTSW 3 38982357 missense probably damaging 0.98
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2152:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R4973:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5384:Fat4 UTSW 3 38995946 missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38887245 missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5443:Fat4 UTSW 3 39010370 missense probably damaging 1.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6590:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
R7017:Fat4 UTSW 3 38891543 missense probably benign
R7030:Fat4 UTSW 3 38981958 missense probably damaging 1.00
R7044:Fat4 UTSW 3 39010810 missense probably benign
R7044:Fat4 UTSW 3 39010811 missense probably benign 0.02
R7045:Fat4 UTSW 3 38888601 missense probably benign 0.01
R7094:Fat4 UTSW 3 38889874 missense probably damaging 1.00
R7111:Fat4 UTSW 3 39010533 missense probably damaging 1.00
R7130:Fat4 UTSW 3 38980787 missense probably damaging 0.99
R7168:Fat4 UTSW 3 38980659 missense probably damaging 1.00
R7192:Fat4 UTSW 3 38980464 missense probably benign 0.04
R7194:Fat4 UTSW 3 38888884 missense probably damaging 1.00
R7194:Fat4 UTSW 3 38983895 missense probably damaging 1.00
R7199:Fat4 UTSW 3 38977362 missense probably damaging 0.98
R7213:Fat4 UTSW 3 38999087 missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38891043 missense probably damaging 1.00
R7225:Fat4 UTSW 3 38980176 missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38890413 missense probably benign 0.31
R7239:Fat4 UTSW 3 38983840 missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38889693 missense probably damaging 1.00
R7296:Fat4 UTSW 3 38889145 nonsense probably null
R7372:Fat4 UTSW 3 38890209 missense probably damaging 1.00
R7400:Fat4 UTSW 3 38887924 missense probably damaging 1.00
R7419:Fat4 UTSW 3 39000236 missense probably damaging 1.00
R7430:Fat4 UTSW 3 38887450 missense probably damaging 0.97
R7430:Fat4 UTSW 3 39009644 missense probably damaging 1.00
R7431:Fat4 UTSW 3 39009157 missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38957427 nonsense probably null
R7501:Fat4 UTSW 3 38958448 nonsense probably null
R7533:Fat4 UTSW 3 39007257 missense probably benign 0.43
R7542:Fat4 UTSW 3 38981355 missense possibly damaging 0.56
R7542:Fat4 UTSW 3 38981621 missense possibly damaging 0.64
R7548:Fat4 UTSW 3 38981114 missense probably benign 0.13
R7567:Fat4 UTSW 3 38889336 missense probably damaging 1.00
R7644:Fat4 UTSW 3 39010241 missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38981160 missense probably benign
R7665:Fat4 UTSW 3 38889178 missense probably benign 0.00
R7676:Fat4 UTSW 3 38891697 missense probably damaging 0.98
R7832:Fat4 UTSW 3 39001204 missense probably benign 0.00
R7848:Fat4 UTSW 3 38887851 missense probably benign
R7883:Fat4 UTSW 3 38981819 missense probably damaging 1.00
R7892:Fat4 UTSW 3 38949439 critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38887541 missense probably damaging 1.00
R7952:Fat4 UTSW 3 38891721 missense probably damaging 0.98
R8015:Fat4 UTSW 3 38981916 missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38981666 missense probably damaging 1.00
R8142:Fat4 UTSW 3 38891203 missense probably damaging 1.00
R8151:Fat4 UTSW 3 38892054 missense probably damaging 0.99
R8163:Fat4 UTSW 3 38979732 missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38958510 missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39008979 critical splice acceptor site probably null
R8447:Fat4 UTSW 3 38979675 missense possibly damaging 0.88
R8458:Fat4 UTSW 3 38981553 missense probably benign 0.25
R8509:Fat4 UTSW 3 38981903 missense probably benign
R8543:Fat4 UTSW 3 38977494 missense probably damaging 1.00
R8679:Fat4 UTSW 3 39010693 missense probably damaging 1.00
R8726:Fat4 UTSW 3 39010498 missense probably damaging 1.00
R8743:Fat4 UTSW 3 38888443 missense probably benign 0.16
R8751:Fat4 UTSW 3 38891853 missense probably benign 0.01
R8779:Fat4 UTSW 3 38979749 missense probably damaging 1.00
R8797:Fat4 UTSW 3 38999129 missense probably benign 0.01
R8860:Fat4 UTSW 3 38892120 missense probably benign 0.26
R8955:Fat4 UTSW 3 38983629 missense probably benign 0.01
R9071:Fat4 UTSW 3 38983449 missense probably benign 0.29
R9088:Fat4 UTSW 3 39007299 missense probably benign 0.02
R9100:Fat4 UTSW 3 39010654 missense
R9180:Fat4 UTSW 3 38888407 missense possibly damaging 0.78
R9184:Fat4 UTSW 3 38982443 missense probably damaging 0.99
R9201:Fat4 UTSW 3 38890930 missense probably damaging 1.00
R9206:Fat4 UTSW 3 39009241 missense probably damaging 0.99
R9268:Fat4 UTSW 3 38888247 missense probably damaging 1.00
R9278:Fat4 UTSW 3 38891022 missense probably benign 0.44
R9287:Fat4 UTSW 3 38891632 missense probably damaging 0.98
R9355:Fat4 UTSW 3 38981898 missense probably damaging 1.00
R9437:Fat4 UTSW 3 38891268 missense probably benign 0.00
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983359 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983815 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38888584 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38890347 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38981838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGGACCATGAACTTGGC -3'
(R):5'- TTGTCATTGAGGTCACGCAC -3'

Sequencing Primer
(F):5'- TGAACTTGGCCGCAAACCG -3'
(R):5'- GGTCACGCACCAGCACTC -3'
Posted On 2021-11-19