Incidental Mutation 'R9053:Slc44a3'
ID 688498
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Name solute carrier family 44, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9053 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 121459528-121532404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121527190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably damaging
Transcript: ENSMUST00000039197
AA Change: Y54C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: Y54C

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,689,275 L121Q probably damaging Het
4930452B06Rik T C 14: 8,518,768 probably null Het
Acat3 A G 17: 12,928,515 V205A probably damaging Het
Acp7 A G 7: 28,617,191 F120L possibly damaging Het
Adh4 T C 3: 138,422,284 V157A probably damaging Het
Ahsa2 T C 11: 23,493,314 E146G probably benign Het
Ank3 T C 10: 69,986,559 S353P Het
Apob T C 12: 8,008,954 S2479P possibly damaging Het
Arhgef37 A G 18: 61,508,689 L203P probably damaging Het
Arpp21 T A 9: 112,155,515 N265I possibly damaging Het
Dagla G A 19: 10,269,251 R162C probably damaging Het
Ddx18 T C 1: 121,561,406 D304G probably damaging Het
Dnah3 A T 7: 120,019,764 L1638Q possibly damaging Het
Dnah6 T A 6: 73,084,657 N2815I possibly damaging Het
Dnajc16 T C 4: 141,783,060 D94G probably benign Het
Epor G T 9: 21,959,359 D408E probably benign Het
Erbb4 T C 1: 68,250,620 N754S possibly damaging Het
Etaa1 A G 11: 17,945,798 I773T probably benign Het
Fam126a A G 5: 23,979,581 C300R possibly damaging Het
Fat4 T A 3: 38,887,175 Y72* probably null Het
Fbxw18 T G 9: 109,688,423 D404A probably benign Het
Flot1 T A 17: 35,829,967 V283E probably damaging Het
Gm5145 G T 17: 20,570,932 G191W probably damaging Het
Helz C A 11: 107,672,935 Q1734K unknown Het
Ints1 A G 5: 139,762,067 V1195A possibly damaging Het
Kmt2a T A 9: 44,821,419 T2534S unknown Het
Lingo3 T C 10: 80,834,987 N370D probably benign Het
Lrp1b A G 2: 40,858,489 V3113A Het
Mthfs C T 9: 89,215,401 L104F probably damaging Het
Nlgn1 A T 3: 25,434,443 V576D probably damaging Het
Nlrc5 A G 8: 94,490,385 R1001G probably benign Het
Obscn C T 11: 59,081,810 A2137T probably benign Het
Ociad1 T A 5: 73,303,608 H70Q probably damaging Het
Olfr1249 A G 2: 89,630,817 V27A probably benign Het
Opa1 T A 16: 29,586,018 C11* probably null Het
Parp10 T C 15: 76,241,764 E408G possibly damaging Het
Pcdhb19 G A 18: 37,498,090 E313K probably benign Het
Pmel G T 10: 128,716,049 A251S probably benign Het
Polr3d G T 14: 70,440,713 P181T probably damaging Het
Prmt3 A T 7: 49,780,356 H69L probably damaging Het
Rc3h2 A T 2: 37,399,616 Y395N possibly damaging Het
Rubcnl A T 14: 75,032,277 N125I possibly damaging Het
Shprh T C 10: 11,154,702 F221S probably benign Het
Skint5 A T 4: 113,546,487 S1179R unknown Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Spag5 A T 11: 78,321,749 I1137F probably benign Het
Tchp A T 5: 114,715,855 Y277F probably benign Het
Tdrd12 A C 7: 35,505,043 L267W probably damaging Het
Tfcp2 A T 15: 100,498,211 I107N Het
Vmn1r9 T C 6: 57,071,528 V196A probably benign Het
Vmn2r62 T A 7: 42,764,496 D841V Het
Zzef1 G T 11: 72,922,476 R2901L probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
R9360:Slc44a3 UTSW 3 121532259 start gained probably benign
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAAGCCCCTCTCTAAGTCGG -3'
(R):5'- CAGCCTCTTGAAGAAGACAAAG -3'

Sequencing Primer
(F):5'- TCTCTAAGTCGGAGCCCTAAC -3'
(R):5'- GCTACACCGGCTACTCCAG -3'
Posted On 2021-11-19