Incidental Mutation 'R9053:Skint6'
ID 688500
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9053 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112804616-113286973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113238150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 104 (G104V)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000138966
AA Change: G104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: G104V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171224
AA Change: G104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: G104V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,689,275 L121Q probably damaging Het
4930452B06Rik T C 14: 8,518,768 probably null Het
Acat3 A G 17: 12,928,515 V205A probably damaging Het
Acp7 A G 7: 28,617,191 F120L possibly damaging Het
Adh4 T C 3: 138,422,284 V157A probably damaging Het
Ahsa2 T C 11: 23,493,314 E146G probably benign Het
Ank3 T C 10: 69,986,559 S353P Het
Apob T C 12: 8,008,954 S2479P possibly damaging Het
Arhgef37 A G 18: 61,508,689 L203P probably damaging Het
Arpp21 T A 9: 112,155,515 N265I possibly damaging Het
Dagla G A 19: 10,269,251 R162C probably damaging Het
Ddx18 T C 1: 121,561,406 D304G probably damaging Het
Dnah3 A T 7: 120,019,764 L1638Q possibly damaging Het
Dnah6 T A 6: 73,084,657 N2815I possibly damaging Het
Dnajc16 T C 4: 141,783,060 D94G probably benign Het
Epor G T 9: 21,959,359 D408E probably benign Het
Erbb4 T C 1: 68,250,620 N754S possibly damaging Het
Etaa1 A G 11: 17,945,798 I773T probably benign Het
Fam126a A G 5: 23,979,581 C300R possibly damaging Het
Fat4 T A 3: 38,887,175 Y72* probably null Het
Fbxw18 T G 9: 109,688,423 D404A probably benign Het
Flot1 T A 17: 35,829,967 V283E probably damaging Het
Gm5145 G T 17: 20,570,932 G191W probably damaging Het
Gpr161 G A 1: 165,306,597 probably benign Het
Helz C A 11: 107,672,935 Q1734K unknown Het
Ints1 A G 5: 139,762,067 V1195A possibly damaging Het
Kmt2a T A 9: 44,821,419 T2534S unknown Het
Lingo3 T C 10: 80,834,987 N370D probably benign Het
Lrp1b A G 2: 40,858,489 V3113A Het
Mthfs C T 9: 89,215,401 L104F probably damaging Het
Nlgn1 A T 3: 25,434,443 V576D probably damaging Het
Nlrc5 A G 8: 94,490,385 R1001G probably benign Het
Obscn C T 11: 59,081,810 A2137T probably benign Het
Ociad1 T A 5: 73,303,608 H70Q probably damaging Het
Olfr1249 A G 2: 89,630,817 V27A probably benign Het
Opa1 T A 16: 29,586,018 C11* probably null Het
Parp10 T C 15: 76,241,764 E408G possibly damaging Het
Pcdhb19 G A 18: 37,498,090 E313K probably benign Het
Pmel G T 10: 128,716,049 A251S probably benign Het
Polr3d G T 14: 70,440,713 P181T probably damaging Het
Prmt3 A T 7: 49,780,356 H69L probably damaging Het
Rc3h2 A T 2: 37,399,616 Y395N possibly damaging Het
Rubcnl A T 14: 75,032,277 N125I possibly damaging Het
Shprh T C 10: 11,154,702 F221S probably benign Het
Skint5 A T 4: 113,546,487 S1179R unknown Het
Slc44a3 T C 3: 121,527,190 Y54C probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Spag5 A T 11: 78,321,749 I1137F probably benign Het
Tchp A T 5: 114,715,855 Y277F probably benign Het
Tdrd12 A C 7: 35,505,043 L267W probably damaging Het
Tfcp2 A T 15: 100,498,211 I107N Het
Vmn1r9 T C 6: 57,071,528 V196A probably benign Het
Vmn2r62 T A 7: 42,764,496 D841V Het
Zzef1 G T 11: 72,922,476 R2901L probably benign Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
meissner UTSW 4 112804694 missense possibly damaging 0.86
Tegmentum UTSW 4 112842822 splice site probably null
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 splice site probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 splice site probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 splice site probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 splice site probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7461:Skint6 UTSW 4 113177046 splice site probably null
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113177046 splice site probably null
R7956:Skint6 UTSW 4 112846697 missense possibly damaging 0.85
R8118:Skint6 UTSW 4 112865675 missense possibly damaging 0.53
R8118:Skint6 UTSW 4 113156494 missense possibly damaging 0.73
R8197:Skint6 UTSW 4 112894843 splice site probably null
R8218:Skint6 UTSW 4 112839274 splice site probably null
R8344:Skint6 UTSW 4 113236445 missense probably damaging 1.00
R8518:Skint6 UTSW 4 113238268 missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113192672 missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112804694 missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112988952 missense probably benign 0.00
R8866:Skint6 UTSW 4 112854453 missense probably benign
R8881:Skint6 UTSW 4 112815519 missense possibly damaging 0.53
R8949:Skint6 UTSW 4 113074099 missense probably benign 0.04
R8967:Skint6 UTSW 4 112872504 nonsense probably null
R9005:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9007:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9055:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9144:Skint6 UTSW 4 113127905 missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113176976 missense probably damaging 0.98
R9297:Skint6 UTSW 4 112811520 missense probably benign 0.00
R9388:Skint6 UTSW 4 113192641 missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113177027 missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112806840 critical splice donor site probably null
R9515:Skint6 UTSW 4 112858178 missense probably benign
R9572:Skint6 UTSW 4 113127931 missense probably benign
R9689:Skint6 UTSW 4 113236349 missense probably damaging 0.99
R9744:Skint6 UTSW 4 112809163 missense probably damaging 1.00
R9785:Skint6 UTSW 4 112883687 missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 112892014 missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113238294 missense probably damaging 0.96
Z1176:Skint6 UTSW 4 113238295 missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112806928 missense possibly damaging 0.96
Z1177:Skint6 UTSW 4 113105961 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATCATCTTGTTAGTCAATCCATGC -3'
(R):5'- AGTTGTCAGTTGTCTCCACCAC -3'

Sequencing Primer
(F):5'- TGTTAGTCAATCCATGCAATAAGAG -3'
(R):5'- CAACAAGCAAAGCACATGGAAATTCG -3'
Posted On 2021-11-19