Incidental Mutation 'R9053:Dnajc16'
ID 688502
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 4732437J24Rik, 2900037O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock # R9053 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141760189-141790931 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141783060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000153880]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
AA Change: D94G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: D94G

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153880
SMART Domains Protein: ENSMUSP00000120783
Gene: ENSMUSG00000040697

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T A 3: 88,689,275 L121Q probably damaging Het
4930452B06Rik T C 14: 8,518,768 probably null Het
Acat3 A G 17: 12,928,515 V205A probably damaging Het
Acp7 A G 7: 28,617,191 F120L possibly damaging Het
Adh4 T C 3: 138,422,284 V157A probably damaging Het
Ahsa2 T C 11: 23,493,314 E146G probably benign Het
Ank3 T C 10: 69,986,559 S353P Het
Apob T C 12: 8,008,954 S2479P possibly damaging Het
Arhgef37 A G 18: 61,508,689 L203P probably damaging Het
Arpp21 T A 9: 112,155,515 N265I possibly damaging Het
Dagla G A 19: 10,269,251 R162C probably damaging Het
Ddx18 T C 1: 121,561,406 D304G probably damaging Het
Dnah3 A T 7: 120,019,764 L1638Q possibly damaging Het
Dnah6 T A 6: 73,084,657 N2815I possibly damaging Het
Epor G T 9: 21,959,359 D408E probably benign Het
Erbb4 T C 1: 68,250,620 N754S possibly damaging Het
Etaa1 A G 11: 17,945,798 I773T probably benign Het
Fam126a A G 5: 23,979,581 C300R possibly damaging Het
Fat4 T A 3: 38,887,175 Y72* probably null Het
Fbxw18 T G 9: 109,688,423 D404A probably benign Het
Flot1 T A 17: 35,829,967 V283E probably damaging Het
Gm5145 G T 17: 20,570,932 G191W probably damaging Het
Gpr161 G A 1: 165,306,597 probably benign Het
Helz C A 11: 107,672,935 Q1734K unknown Het
Ints1 A G 5: 139,762,067 V1195A possibly damaging Het
Kmt2a T A 9: 44,821,419 T2534S unknown Het
Lingo3 T C 10: 80,834,987 N370D probably benign Het
Lrp1b A G 2: 40,858,489 V3113A Het
Mthfs C T 9: 89,215,401 L104F probably damaging Het
Nlgn1 A T 3: 25,434,443 V576D probably damaging Het
Nlrc5 A G 8: 94,490,385 R1001G probably benign Het
Obscn C T 11: 59,081,810 A2137T probably benign Het
Ociad1 T A 5: 73,303,608 H70Q probably damaging Het
Olfr1249 A G 2: 89,630,817 V27A probably benign Het
Opa1 T A 16: 29,586,018 C11* probably null Het
Parp10 T C 15: 76,241,764 E408G possibly damaging Het
Pcdhb19 G A 18: 37,498,090 E313K probably benign Het
Pmel G T 10: 128,716,049 A251S probably benign Het
Polr3d G T 14: 70,440,713 P181T probably damaging Het
Prmt3 A T 7: 49,780,356 H69L probably damaging Het
Rc3h2 A T 2: 37,399,616 Y395N possibly damaging Het
Rubcnl A T 14: 75,032,277 N125I possibly damaging Het
Shprh T C 10: 11,154,702 F221S probably benign Het
Skint5 A T 4: 113,546,487 S1179R unknown Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slc44a3 T C 3: 121,527,190 Y54C probably damaging Het
Sp140 TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTT 1: 85,644,569 probably benign Het
Spag5 A T 11: 78,321,749 I1137F probably benign Het
Tchp A T 5: 114,715,855 Y277F probably benign Het
Tdrd12 A C 7: 35,505,043 L267W probably damaging Het
Tfcp2 A T 15: 100,498,211 I107N Het
Vmn1r9 T C 6: 57,071,528 V196A probably benign Het
Vmn2r62 T A 7: 42,764,496 D841V Het
Zzef1 G T 11: 72,922,476 R2901L probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
R9005:Dnajc16 UTSW 4 141764634 missense possibly damaging 0.95
R9550:Dnajc16 UTSW 4 141767747 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAAGCACTTCATTCACGTAG -3'
(R):5'- TCGTTCAGGTTGCTTACAGG -3'

Sequencing Primer
(F):5'- CGTAGTGTGAGAAGTGCAGC -3'
(R):5'- GCTTACAGGAAAGCCATTTAGG -3'
Posted On 2021-11-19