Incidental Mutation 'R9054:Psg18'
ID 688564
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9054 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18353525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 69 (R69S)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect possibly damaging
Transcript: ENSMUST00000003597
AA Change: R69S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: R69S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098783
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankef1 T A 2: 136,553,674 D641E probably benign Het
Anln A G 9: 22,360,820 probably null Het
Areg A T 5: 91,144,358 E172D probably damaging Het
Ccdc51 A T 9: 109,089,414 T24S probably benign Het
Cckar A T 5: 53,703,082 I135N probably damaging Het
Cdca7 CGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGGA CGAGGAAGAGGAGGAGGAAGAGGA 2: 72,483,477 probably benign Het
Cep295 T C 9: 15,324,255 H2056R possibly damaging Het
Chrnb2 T C 3: 89,757,255 K451E probably damaging Het
Ctnna2 C T 6: 76,942,266 R663Q probably benign Het
Cyp4f37 A T 17: 32,634,279 I406F probably benign Het
Fkrp G T 7: 16,810,644 T431K probably damaging Het
Fsip2 A T 2: 82,975,836 Y833F possibly damaging Het
Galnt2 T C 8: 124,332,098 probably null Het
Gm13101 T C 4: 143,965,744 Q229R probably benign Het
Gm8180 T A 14: 43,782,349 probably null Het
Gm8882 G C 6: 132,361,893 Q121E unknown Het
Hcn1 T C 13: 117,971,635 S552P unknown Het
Ifit1 A C 19: 34,648,487 E341A possibly damaging Het
Krt72 A T 15: 101,786,401 S20T probably damaging Het
Lipn A T 19: 34,076,976 I205F possibly damaging Het
Nat1 G T 8: 67,491,071 R36L probably benign Het
Nebl A T 2: 17,411,096 M334K possibly damaging Het
Nectin4 A T 1: 171,386,783 N502I probably damaging Het
Nrp1 G A 8: 128,487,908 V626I probably benign Het
Olfr160 C T 9: 37,711,908 V124M probably damaging Het
Olfr692 A G 7: 105,368,473 Y49C probably damaging Het
Pde2a A G 7: 101,507,720 Y637C probably damaging Het
Pde4d T C 13: 109,935,390 V306A probably damaging Het
Pdzd9 G A 7: 120,670,275 probably benign Het
Pitpnm3 T A 11: 72,056,191 D810V probably damaging Het
Pkd1l3 A T 8: 109,665,672 H1966L probably benign Het
Pmfbp1 C T 8: 109,521,029 T319I possibly damaging Het
Ptprg A T 14: 12,213,638 Q1002L possibly damaging Het
Ptprj T C 2: 90,460,640 Y585C probably damaging Het
Rad51c T C 11: 87,402,716 T105A probably benign Het
Rbm12 A T 2: 156,095,561 D930E unknown Het
Rlf A C 4: 121,150,587 S509A possibly damaging Het
Slc39a3 C A 10: 81,033,665 G53C probably damaging Het
Smchd1 G A 17: 71,363,022 Q1685* probably null Het
Sprr2d A C 3: 92,340,408 E52A unknown Het
Stat1 A G 1: 52,142,927 N355S probably damaging Het
Tmem30b T C 12: 73,546,149 E64G probably benign Het
Ttll11 A T 2: 35,979,380 V82D probably benign Het
Ttn T A 2: 76,740,633 T26639S probably damaging Het
Usp53 A T 3: 122,934,076 N952K probably benign Het
Vmn1r199 T A 13: 22,383,554 H339Q possibly damaging Het
Vps13b G A 15: 35,422,391 D166N probably damaging Het
Zfp954 C A 7: 7,116,098 C149F probably benign Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TACACGTGCAAGTACAGGGATG -3'
(R):5'- ACCTGCTCATTATTGGTGGC -3'

Sequencing Primer
(F):5'- CACGTGCAAGTACAGGGATGTATTTG -3'
(R):5'- GCTCATTATTGGTGGCTTCTC -3'
Posted On 2021-11-19