Incidental Mutation 'R9054:Tmem30b'
ID 688580
Institutional Source Beutler Lab
Gene Symbol Tmem30b
Ensembl Gene ENSMUSG00000034435
Gene Name transmembrane protein 30B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9054 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73543402-73546392 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73546149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 64 (E64G)
Ref Sequence ENSEMBL: ENSMUSP00000037476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042975]
AlphaFold Q8BHG3
Predicted Effect probably benign
Transcript: ENSMUST00000042975
AA Change: E64G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037476
Gene: ENSMUSG00000034435
AA Change: E64G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Pfam:CDC50 54 347 3.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankef1 T A 2: 136,553,674 D641E probably benign Het
Anln A G 9: 22,360,820 probably null Het
Areg A T 5: 91,144,358 E172D probably damaging Het
Ccdc51 A T 9: 109,089,414 T24S probably benign Het
Cckar A T 5: 53,703,082 I135N probably damaging Het
Cdca7 CGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGGA CGAGGAAGAGGAGGAGGAAGAGGA 2: 72,483,477 probably benign Het
Cep295 T C 9: 15,324,255 H2056R possibly damaging Het
Chrnb2 T C 3: 89,757,255 K451E probably damaging Het
Ctnna2 C T 6: 76,942,266 R663Q probably benign Het
Cyp4f37 A T 17: 32,634,279 I406F probably benign Het
Fkrp G T 7: 16,810,644 T431K probably damaging Het
Fsip2 A T 2: 82,975,836 Y833F possibly damaging Het
Galnt2 T C 8: 124,332,098 probably null Het
Gm13101 T C 4: 143,965,744 Q229R probably benign Het
Gm8180 T A 14: 43,782,349 probably null Het
Gm8882 G C 6: 132,361,893 Q121E unknown Het
Hcn1 T C 13: 117,971,635 S552P unknown Het
Ifit1 A C 19: 34,648,487 E341A possibly damaging Het
Krt72 A T 15: 101,786,401 S20T probably damaging Het
Lipn A T 19: 34,076,976 I205F possibly damaging Het
Nat1 G T 8: 67,491,071 R36L probably benign Het
Nebl A T 2: 17,411,096 M334K possibly damaging Het
Nectin4 A T 1: 171,386,783 N502I probably damaging Het
Nrp1 G A 8: 128,487,908 V626I probably benign Het
Olfr160 C T 9: 37,711,908 V124M probably damaging Het
Olfr692 A G 7: 105,368,473 Y49C probably damaging Het
Pde2a A G 7: 101,507,720 Y637C probably damaging Het
Pde4d T C 13: 109,935,390 V306A probably damaging Het
Pdzd9 G A 7: 120,670,275 probably benign Het
Pitpnm3 T A 11: 72,056,191 D810V probably damaging Het
Pkd1l3 A T 8: 109,665,672 H1966L probably benign Het
Pmfbp1 C T 8: 109,521,029 T319I possibly damaging Het
Psg18 T A 7: 18,353,525 R69S possibly damaging Het
Ptprg A T 14: 12,213,638 Q1002L possibly damaging Het
Ptprj T C 2: 90,460,640 Y585C probably damaging Het
Rad51c T C 11: 87,402,716 T105A probably benign Het
Rbm12 A T 2: 156,095,561 D930E unknown Het
Rlf A C 4: 121,150,587 S509A possibly damaging Het
Slc39a3 C A 10: 81,033,665 G53C probably damaging Het
Smchd1 G A 17: 71,363,022 Q1685* probably null Het
Sprr2d A C 3: 92,340,408 E52A unknown Het
Stat1 A G 1: 52,142,927 N355S probably damaging Het
Ttll11 A T 2: 35,979,380 V82D probably benign Het
Ttn T A 2: 76,740,633 T26639S probably damaging Het
Usp53 A T 3: 122,934,076 N952K probably benign Het
Vmn1r199 T A 13: 22,383,554 H339Q possibly damaging Het
Vps13b G A 15: 35,422,391 D166N probably damaging Het
Zfp954 C A 7: 7,116,098 C149F probably benign Het
Other mutations in Tmem30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tmem30b UTSW 12 73546005 missense probably damaging 1.00
R0492:Tmem30b UTSW 12 73546168 missense probably benign 0.24
R0707:Tmem30b UTSW 12 73546168 missense probably benign 0.24
R2135:Tmem30b UTSW 12 73545333 missense probably damaging 1.00
R3615:Tmem30b UTSW 12 73545579 missense probably damaging 1.00
R3616:Tmem30b UTSW 12 73545579 missense probably damaging 1.00
R4858:Tmem30b UTSW 12 73545912 missense probably damaging 1.00
R4922:Tmem30b UTSW 12 73545714 missense probably damaging 1.00
R5649:Tmem30b UTSW 12 73546166 missense probably benign 0.10
R7391:Tmem30b UTSW 12 73545928 missense probably benign 0.00
R7521:Tmem30b UTSW 12 73545318 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACTTGACGTGGTAGTCGGTC -3'
(R):5'- CTGATCCTGGGTTGAGAGTC -3'

Sequencing Primer
(F):5'- TGGTAGTCGGTCCACCAG -3'
(R):5'- TGAGATCCCCGCCATGAC -3'
Posted On 2021-11-19