Incidental Mutation 'R9054:Lipn'
ID 688590
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9054 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34067358-34084918 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34076976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 205 (I205F)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000025682
AA Change: I205F

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: I205F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126710
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankef1 T A 2: 136,553,674 D641E probably benign Het
Anln A G 9: 22,360,820 probably null Het
Areg A T 5: 91,144,358 E172D probably damaging Het
Ccdc51 A T 9: 109,089,414 T24S probably benign Het
Cckar A T 5: 53,703,082 I135N probably damaging Het
Cdca7 CGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGGA CGAGGAAGAGGAGGAGGAAGAGGA 2: 72,483,477 probably benign Het
Cep295 T C 9: 15,324,255 H2056R possibly damaging Het
Chrnb2 T C 3: 89,757,255 K451E probably damaging Het
Ctnna2 C T 6: 76,942,266 R663Q probably benign Het
Cyp4f37 A T 17: 32,634,279 I406F probably benign Het
Eml4 T A 17: 83,427,211 probably benign Het
Fkrp G T 7: 16,810,644 T431K probably damaging Het
Fsip2 A T 2: 82,975,836 Y833F possibly damaging Het
Galnt2 T C 8: 124,332,098 probably null Het
Gm13101 T C 4: 143,965,744 Q229R probably benign Het
Gm8180 T A 14: 43,782,349 probably null Het
Gm8882 G C 6: 132,361,893 Q121E unknown Het
Hcn1 T C 13: 117,971,635 S552P unknown Het
Ifit1 A C 19: 34,648,487 E341A possibly damaging Het
Iyd A G 10: 3,540,250 probably benign Het
Krt72 A T 15: 101,786,401 S20T probably damaging Het
Lemd2 G T 17: 27,204,095 D108E probably benign Het
Nat1 G T 8: 67,491,071 R36L probably benign Het
Nebl A T 2: 17,411,096 M334K possibly damaging Het
Nectin4 A T 1: 171,386,783 N502I probably damaging Het
Nrp1 G A 8: 128,487,908 V626I probably benign Het
Olfr160 C T 9: 37,711,908 V124M probably damaging Het
Olfr692 A G 7: 105,368,473 Y49C probably damaging Het
Oprm1 G A 10: 6,823,914 probably benign Het
Pde2a A G 7: 101,507,720 Y637C probably damaging Het
Pde4d T C 13: 109,935,390 V306A probably damaging Het
Pdzd9 G A 7: 120,670,275 probably benign Het
Pitpnm3 T A 11: 72,056,191 D810V probably damaging Het
Pkd1l3 A T 8: 109,665,672 H1966L probably benign Het
Pmfbp1 C T 8: 109,521,029 T319I possibly damaging Het
Psg18 T A 7: 18,353,525 R69S possibly damaging Het
Ptprg A T 14: 12,213,638 Q1002L possibly damaging Het
Ptprj T C 2: 90,460,640 Y585C probably damaging Het
Rad51c T C 11: 87,402,716 T105A probably benign Het
Rbm12 A T 2: 156,095,561 D930E unknown Het
Rlf A C 4: 121,150,587 S509A possibly damaging Het
Slc39a3 C A 10: 81,033,665 G53C probably damaging Het
Smchd1 G A 17: 71,363,022 Q1685* probably null Het
Sprr2d A C 3: 92,340,408 E52A unknown Het
Stat1 A G 1: 52,142,927 N355S probably damaging Het
Tmem30b T C 12: 73,546,149 E64G probably benign Het
Ttll11 A T 2: 35,979,380 V82D probably benign Het
Ttn T A 2: 76,740,633 T26639S probably damaging Het
Usp53 A T 3: 122,934,076 N952K probably benign Het
Vmn1r199 T A 13: 22,383,554 H339Q possibly damaging Het
Vps13b G A 15: 35,422,391 D166N probably damaging Het
Zfp954 C A 7: 7,116,098 C149F probably benign Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
R8824:Lipn UTSW 19 34084716 missense probably benign 0.04
R8894:Lipn UTSW 19 34084848 makesense probably null
R8933:Lipn UTSW 19 34069480 missense probably damaging 0.98
R9117:Lipn UTSW 19 34068641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAGCCGAAGTACAATGTTG -3'
(R):5'- CACGTTGAAGTACATCCTCATGG -3'

Sequencing Primer
(F):5'- CGAAGTACAATGTTGCAGAAACC -3'
(R):5'- GTACATCCTCATGGACTCTGATTTC -3'
Posted On 2021-11-19