Incidental Mutation 'R9055:Skint6'
ID 688610
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9055 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112804616-113286973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113238150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 104 (G104V)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000138966
AA Change: G104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: G104V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171224
AA Change: G104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: G104V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,041,966 T753S probably benign Het
Acy3 A G 19: 3,988,178 E157G probably benign Het
Adamts20 A G 15: 94,283,986 Y1609H probably damaging Het
Ahnak2 C T 12: 112,774,585 A1018T possibly damaging Het
Ahsg T A 16: 22,892,319 W69R possibly damaging Het
Alox12 T G 11: 70,253,077 D159A probably damaging Het
Alox12b C G 11: 69,164,058 P296A possibly damaging Het
Ankrd17 T C 5: 90,232,309 I2507V probably benign Het
Apeh T C 9: 108,085,846 M670V possibly damaging Het
Aqp12 C T 1: 93,006,905 A168V probably benign Het
BC030499 A G 11: 78,293,547 D240G probably damaging Het
Ceacam1 A T 7: 25,471,874 D388E probably damaging Het
Clp1 A T 2: 84,723,922 I301N probably damaging Het
Cntn3 A G 6: 102,267,437 F384L probably benign Het
Dnpep A T 1: 75,315,161 M238K possibly damaging Het
Dync2h1 A T 9: 6,996,641 probably benign Het
Edc3 T A 9: 57,716,077 N98K probably benign Het
Egr3 T A 14: 70,078,900 N15K probably damaging Het
Fbxo25 T A 8: 13,915,023 C25S possibly damaging Het
Fgd4 T A 16: 16,422,630 D745V possibly damaging Het
Flnb T A 14: 7,908,553 D1310E probably benign Het
Ggnbp2 A G 11: 84,841,622 F215S probably damaging Het
Gm10130 G A 2: 150,323,833 probably benign Het
Gm1979 C T 5: 26,002,034 R107Q probably benign Het
Gm4847 T A 1: 166,640,108 H173L probably damaging Het
Gmeb1 A T 4: 132,237,114 L146H probably damaging Het
Gpr88 A G 3: 116,252,651 S4P unknown Het
Gucy1a1 A G 3: 82,109,126 L185P possibly damaging Het
Hsd3b6 G T 3: 98,806,668 T105N probably damaging Het
Iqca T C 1: 90,070,613 Y546C probably benign Het
Irf1 T A 11: 53,776,370 I305N probably benign Het
Itgb3 G A 11: 104,665,625 W764* probably null Het
Klra8 G T 6: 130,119,054 R192S probably benign Het
Krt79 T A 15: 101,931,487 I358F probably damaging Het
Mettl4 T C 17: 94,740,415 D266G possibly damaging Het
Mfsd8 G A 3: 40,832,058 A219V probably benign Het
Mgam G A 6: 40,714,729 probably benign Het
Nek9 A T 12: 85,301,842 C973S probably damaging Het
Olfr1309 A T 2: 111,983,704 Y123* probably null Het
Olfr267 G T 4: 58,785,374 A116E possibly damaging Het
Olfr891 T C 9: 38,180,484 Y113C probably damaging Het
Ostc T A 3: 130,709,371 E2V probably damaging Het
Ostc C A 3: 130,709,372 E2* probably null Het
Pcdhb8 T A 18: 37,357,532 C754* probably null Het
Polr1a A G 6: 71,915,069 T111A possibly damaging Het
Prep C T 10: 45,115,195 T319M probably benign Het
Reg3b A C 6: 78,372,903 D142A possibly damaging Het
Retsat A G 6: 72,606,953 D537G probably benign Het
Rnf2 G A 1: 151,476,279 L109F probably damaging Het
Runx3 G T 4: 135,175,345 R262L probably damaging Het
Rwdd3 G T 3: 121,159,222 T112K probably benign Het
Scfd2 T C 5: 74,531,270 H117R possibly damaging Het
Scn10a C T 9: 119,622,892 V1321M probably damaging Het
Sec31a T C 5: 100,386,181 E119G possibly damaging Het
Slc18a1 T A 8: 69,068,171 I199F possibly damaging Het
St18 C T 1: 6,802,982 R314* probably null Het
Sucla2 T G 14: 73,581,628 probably benign Het
Sulf1 A T 1: 12,807,963 H225L probably damaging Het
Tas2r140 A G 6: 133,055,417 V126A possibly damaging Het
Tcp10b T C 17: 13,062,941 I66T probably damaging Het
Tmem45a2 T C 16: 57,040,752 I237M probably benign Het
Traf3ip1 C T 1: 91,501,011 R167* probably null Het
Trav17 T G 14: 53,806,863 V30G probably damaging Het
Vmn1r54 A G 6: 90,269,118 N5D probably benign Het
Vmn2r81 A G 10: 79,274,607 H518R probably benign Het
Washc3 A G 10: 88,216,054 T102A probably benign Het
Xaf1 A G 11: 72,303,440 H49R probably damaging Het
Zfp276 T C 8: 123,258,370 F356L probably damaging Het
Zfp398 G T 6: 47,866,385 R457L possibly damaging Het
Zfp512 G T 5: 31,480,189 E541* probably null Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
meissner UTSW 4 112804694 missense possibly damaging 0.86
Tegmentum UTSW 4 112842822 splice site probably null
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 splice site probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 splice site probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 splice site probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 splice site probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7461:Skint6 UTSW 4 113177046 splice site probably null
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113177046 splice site probably null
R7956:Skint6 UTSW 4 112846697 missense possibly damaging 0.85
R8118:Skint6 UTSW 4 112865675 missense possibly damaging 0.53
R8118:Skint6 UTSW 4 113156494 missense possibly damaging 0.73
R8197:Skint6 UTSW 4 112894843 splice site probably null
R8218:Skint6 UTSW 4 112839274 splice site probably null
R8344:Skint6 UTSW 4 113236445 missense probably damaging 1.00
R8518:Skint6 UTSW 4 113238268 missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112804688 missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113192672 missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112804694 missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112988952 missense probably benign 0.00
R8866:Skint6 UTSW 4 112854453 missense probably benign
R8881:Skint6 UTSW 4 112815519 missense possibly damaging 0.53
R8949:Skint6 UTSW 4 113074099 missense probably benign 0.04
R8967:Skint6 UTSW 4 112872504 nonsense probably null
R9005:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9007:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9053:Skint6 UTSW 4 113238150 missense probably damaging 1.00
R9144:Skint6 UTSW 4 113127905 missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113176976 missense probably damaging 0.98
R9297:Skint6 UTSW 4 112811520 missense probably benign 0.00
R9388:Skint6 UTSW 4 113192641 missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113177027 missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112806840 critical splice donor site probably null
R9515:Skint6 UTSW 4 112858178 missense probably benign
R9572:Skint6 UTSW 4 113127931 missense probably benign
R9689:Skint6 UTSW 4 113236349 missense probably damaging 0.99
R9744:Skint6 UTSW 4 112809163 missense probably damaging 1.00
R9785:Skint6 UTSW 4 112883687 missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 112892014 missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113238294 missense probably damaging 0.96
Z1176:Skint6 UTSW 4 113238295 missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112806928 missense possibly damaging 0.96
Z1177:Skint6 UTSW 4 113105961 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATCATCTTGTTAGTCAATCCATGC -3'
(R):5'- TAGAACTCAGTTGTCAGTTGTCTC -3'

Sequencing Primer
(F):5'- TGTTAGTCAATCCATGCAATAAGAG -3'
(R):5'- AGTTGTCAGTTGTCTCCACCAC -3'
Posted On 2021-11-19