Incidental Mutation 'R9055:Polr1a'
ID 688619
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71909053-71984935 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71915069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
AlphaFold O35134
Predicted Effect possibly damaging
Transcript: ENSMUST00000055296
AA Change: T111A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: T111A

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000206556
AA Change: T111A

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,041,966 T753S probably benign Het
Acy3 A G 19: 3,988,178 E157G probably benign Het
Adamts20 A G 15: 94,283,986 Y1609H probably damaging Het
Ahnak2 C T 12: 112,774,585 A1018T possibly damaging Het
Ahsg T A 16: 22,892,319 W69R possibly damaging Het
Alox12 T G 11: 70,253,077 D159A probably damaging Het
Alox12b C G 11: 69,164,058 P296A possibly damaging Het
Ankrd17 T C 5: 90,232,309 I2507V probably benign Het
Apeh T C 9: 108,085,846 M670V possibly damaging Het
Aqp12 C T 1: 93,006,905 A168V probably benign Het
BC030499 A G 11: 78,293,547 D240G probably damaging Het
Ceacam1 A T 7: 25,471,874 D388E probably damaging Het
Clp1 A T 2: 84,723,922 I301N probably damaging Het
Cntn3 A G 6: 102,267,437 F384L probably benign Het
Dnpep A T 1: 75,315,161 M238K possibly damaging Het
Edc3 T A 9: 57,716,077 N98K probably benign Het
Egr3 T A 14: 70,078,900 N15K probably damaging Het
Fbxo25 T A 8: 13,915,023 C25S possibly damaging Het
Fgd4 T A 16: 16,422,630 D745V possibly damaging Het
Flnb T A 14: 7,908,553 D1310E probably benign Het
Ggnbp2 A G 11: 84,841,622 F215S probably damaging Het
Gm1979 C T 5: 26,002,034 R107Q probably benign Het
Gm4847 T A 1: 166,640,108 H173L probably damaging Het
Gmeb1 A T 4: 132,237,114 L146H probably damaging Het
Gpr88 A G 3: 116,252,651 S4P unknown Het
Gucy1a1 A G 3: 82,109,126 L185P possibly damaging Het
Hsd3b6 G T 3: 98,806,668 T105N probably damaging Het
Iqca T C 1: 90,070,613 Y546C probably benign Het
Irf1 T A 11: 53,776,370 I305N probably benign Het
Itgb3 G A 11: 104,665,625 W764* probably null Het
Klra8 G T 6: 130,119,054 R192S probably benign Het
Krt79 T A 15: 101,931,487 I358F probably damaging Het
Mettl4 T C 17: 94,740,415 D266G possibly damaging Het
Mfsd8 G A 3: 40,832,058 A219V probably benign Het
Nek9 A T 12: 85,301,842 C973S probably damaging Het
Olfr1309 A T 2: 111,983,704 Y123* probably null Het
Olfr267 G T 4: 58,785,374 A116E possibly damaging Het
Olfr891 T C 9: 38,180,484 Y113C probably damaging Het
Ostc T A 3: 130,709,371 E2V probably damaging Het
Ostc C A 3: 130,709,372 E2* probably null Het
Pcdhb8 T A 18: 37,357,532 C754* probably null Het
Prep C T 10: 45,115,195 T319M probably benign Het
Reg3b A C 6: 78,372,903 D142A possibly damaging Het
Retsat A G 6: 72,606,953 D537G probably benign Het
Rnf2 G A 1: 151,476,279 L109F probably damaging Het
Runx3 G T 4: 135,175,345 R262L probably damaging Het
Rwdd3 G T 3: 121,159,222 T112K probably benign Het
Scfd2 T C 5: 74,531,270 H117R possibly damaging Het
Scn10a C T 9: 119,622,892 V1321M probably damaging Het
Sec31a T C 5: 100,386,181 E119G possibly damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slc18a1 T A 8: 69,068,171 I199F possibly damaging Het
St18 C T 1: 6,802,982 R314* probably null Het
Sulf1 A T 1: 12,807,963 H225L probably damaging Het
Tas2r140 A G 6: 133,055,417 V126A possibly damaging Het
Tcp10b T C 17: 13,062,941 I66T probably damaging Het
Tmem45a2 T C 16: 57,040,752 I237M probably benign Het
Traf3ip1 C T 1: 91,501,011 R167* probably null Het
Trav17 T G 14: 53,806,863 V30G probably damaging Het
Vmn1r54 A G 6: 90,269,118 N5D probably benign Het
Vmn2r81 A G 10: 79,274,607 H518R probably benign Het
Washc3 A G 10: 88,216,054 T102A probably benign Het
Xaf1 A G 11: 72,303,440 H49R probably damaging Het
Zfp276 T C 8: 123,258,370 F356L probably damaging Het
Zfp398 G T 6: 47,866,385 R457L possibly damaging Het
Zfp512 G T 5: 31,480,189 E541* probably null Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
R9088:Polr1a UTSW 6 71931783 missense probably benign 0.26
R9211:Polr1a UTSW 6 71966537 missense probably damaging 1.00
R9228:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R9240:Polr1a UTSW 6 71963677 nonsense probably null
R9267:Polr1a UTSW 6 71965558 missense probably benign
R9302:Polr1a UTSW 6 71924699 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCTGGTTGTTAGAGTCTAAAAGC -3'
(R):5'- GCAAGGGCCAAAACATTCTG -3'

Sequencing Primer
(F):5'- GTTAGAGTCTAAAAGCTATTGAGGC -3'
(R):5'- CCAAAACATTCTGGAGACTGCTTAGG -3'
Posted On 2021-11-19