Incidental Mutation 'R9055:Klra8'
ID 688624
Institutional Source Beutler Lab
Gene Symbol Klra8
Ensembl Gene ENSMUSG00000089727
Gene Name killer cell lectin-like receptor, subfamily A, member 8
Synonyms Ly49u<129>, Ly49h, Cmv1, Cmv-1
MMRRC Submission 068881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9055 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 130092189-130106861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 130096017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 192 (R192S)
Ref Sequence ENSEMBL: ENSMUSP00000014476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014476]
AlphaFold Q60682
PDB Structure Crystal structure of the activating Ly49H receptor in complex with m157 (G1F strain) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000014476
AA Change: R192S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000014476
Gene: ENSMUSG00000089727
AA Change: R192S

DomainStartEndE-ValueType
Blast:CLECT 73 124 9e-8 BLAST
CLECT 143 258 6.53e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Most mouse strains other than C57BL/6 and C57BL/10 lack this gene and this correlates with an increased susceptiblity to CMV infection. A congenic strain in which the CMV resistant allele from C57BL/6 mice has been introduced in the BALB/c background shows high susceptibility to malarial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,030,398 (GRCm39) T753S probably benign Het
Acy3 A G 19: 4,038,178 (GRCm39) E157G probably benign Het
Adamts20 A G 15: 94,181,867 (GRCm39) Y1609H probably damaging Het
Ahnak2 C T 12: 112,741,019 (GRCm39) A1018T possibly damaging Het
Ahsg T A 16: 22,711,069 (GRCm39) W69R possibly damaging Het
Alox12 T G 11: 70,143,903 (GRCm39) D159A probably damaging Het
Alox12b C G 11: 69,054,884 (GRCm39) P296A possibly damaging Het
Ankrd17 T C 5: 90,380,168 (GRCm39) I2507V probably benign Het
Apeh T C 9: 107,963,045 (GRCm39) M670V possibly damaging Het
Aqp12 C T 1: 92,934,627 (GRCm39) A168V probably benign Het
Ceacam1 A T 7: 25,171,299 (GRCm39) D388E probably damaging Het
Clp1 A T 2: 84,554,266 (GRCm39) I301N probably damaging Het
Cntn3 A G 6: 102,244,398 (GRCm39) F384L probably benign Het
Dnpep A T 1: 75,291,805 (GRCm39) M238K possibly damaging Het
Dync2h1 A T 9: 6,996,641 (GRCm39) probably benign Het
Edc3 T A 9: 57,623,360 (GRCm39) N98K probably benign Het
Egr3 T A 14: 70,316,349 (GRCm39) N15K probably damaging Het
Fbxo25 T A 8: 13,965,023 (GRCm39) C25S possibly damaging Het
Fgd4 T A 16: 16,240,494 (GRCm39) D745V possibly damaging Het
Flnb T A 14: 7,908,553 (GRCm38) D1310E probably benign Het
Ggnbp2 A G 11: 84,732,448 (GRCm39) F215S probably damaging Het
Gm1979 C T 5: 26,207,032 (GRCm39) R107Q probably benign Het
Gm4847 T A 1: 166,467,677 (GRCm39) H173L probably damaging Het
Gmeb1 A T 4: 131,964,425 (GRCm39) L146H probably damaging Het
Gpr88 A G 3: 116,046,300 (GRCm39) S4P unknown Het
Gucy1a1 A G 3: 82,016,433 (GRCm39) L185P possibly damaging Het
Hsd3b6 G T 3: 98,713,984 (GRCm39) T105N probably damaging Het
Iqca1 T C 1: 89,998,335 (GRCm39) Y546C probably benign Het
Irf1 T A 11: 53,667,196 (GRCm39) I305N probably benign Het
Itgb3 G A 11: 104,556,451 (GRCm39) W764* probably null Het
Krt79 T A 15: 101,839,922 (GRCm39) I358F probably damaging Het
Mettl4 T C 17: 95,047,843 (GRCm39) D266G possibly damaging Het
Mfsd8 G A 3: 40,786,493 (GRCm39) A219V probably benign Het
Mgam G A 6: 40,691,663 (GRCm39) probably benign Het
Nek9 A T 12: 85,348,616 (GRCm39) C973S probably damaging Het
Or2k2 G T 4: 58,785,374 (GRCm39) A116E possibly damaging Het
Or4f15 A T 2: 111,814,049 (GRCm39) Y123* probably null Het
Or8c13 T C 9: 38,091,780 (GRCm39) Y113C probably damaging Het
Ostc T A 3: 130,503,020 (GRCm39) E2V probably damaging Het
Ostc C A 3: 130,503,021 (GRCm39) E2* probably null Het
Pcdhb8 T A 18: 37,490,585 (GRCm39) C754* probably null Het
Polr1a A G 6: 71,892,053 (GRCm39) T111A possibly damaging Het
Prep C T 10: 44,991,291 (GRCm39) T319M probably benign Het
Reg3b A C 6: 78,349,886 (GRCm39) D142A possibly damaging Het
Retsat A G 6: 72,583,936 (GRCm39) D537G probably benign Het
Rnf2 G A 1: 151,352,030 (GRCm39) L109F probably damaging Het
Rskr A G 11: 78,184,373 (GRCm39) D240G probably damaging Het
Runx3 G T 4: 134,902,656 (GRCm39) R262L probably damaging Het
Rwdd3 G T 3: 120,952,871 (GRCm39) T112K probably benign Het
Scfd2 T C 5: 74,691,931 (GRCm39) H117R possibly damaging Het
Scn10a C T 9: 119,451,958 (GRCm39) V1321M probably damaging Het
Sec31a T C 5: 100,534,040 (GRCm39) E119G possibly damaging Het
Skint6 C A 4: 113,095,347 (GRCm39) G104V probably damaging Het
Slc18a1 T A 8: 69,520,823 (GRCm39) I199F possibly damaging Het
St18 C T 1: 6,873,206 (GRCm39) R314* probably null Het
Sucla2 T G 14: 73,819,068 (GRCm39) probably benign Het
Sulf1 A T 1: 12,878,187 (GRCm39) H225L probably damaging Het
Tas2r140 A G 6: 133,032,380 (GRCm39) V126A possibly damaging Het
Tcp10b T C 17: 13,281,828 (GRCm39) I66T probably damaging Het
Tmem45a2 T C 16: 56,861,115 (GRCm39) I237M probably benign Het
Traf3ip1 C T 1: 91,428,733 (GRCm39) R167* probably null Het
Trav17 T G 14: 54,044,320 (GRCm39) V30G probably damaging Het
Vmn1r54 A G 6: 90,246,100 (GRCm39) N5D probably benign Het
Vmn2r81 A G 10: 79,110,441 (GRCm39) H518R probably benign Het
Washc3 A G 10: 88,051,916 (GRCm39) T102A probably benign Het
Xaf1 A G 11: 72,194,266 (GRCm39) H49R probably damaging Het
Zfp1001 G A 2: 150,165,753 (GRCm39) probably benign Het
Zfp276 T C 8: 123,985,109 (GRCm39) F356L probably damaging Het
Zfp398 G T 6: 47,843,319 (GRCm39) R457L possibly damaging Het
Zfp512 G T 5: 31,637,533 (GRCm39) E541* probably null Het
Other mutations in Klra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Klra8 APN 6 130,092,561 (GRCm39) missense probably benign
IGL01786:Klra8 APN 6 130,096,031 (GRCm39) critical splice acceptor site probably null
IGL02145:Klra8 APN 6 130,102,199 (GRCm39) missense probably benign 0.01
IGL02531:Klra8 APN 6 130,095,933 (GRCm39) missense possibly damaging 0.67
P4748:Klra8 UTSW 6 130,099,007 (GRCm39) missense possibly damaging 0.51
R0082:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.00
R0853:Klra8 UTSW 6 130,095,977 (GRCm39) missense probably damaging 1.00
R1517:Klra8 UTSW 6 130,092,603 (GRCm39) missense probably benign 0.02
R1610:Klra8 UTSW 6 130,095,981 (GRCm39) missense probably damaging 1.00
R1669:Klra8 UTSW 6 130,092,592 (GRCm39) nonsense probably null
R2015:Klra8 UTSW 6 130,092,536 (GRCm39) missense probably damaging 1.00
R3784:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.02
R6909:Klra8 UTSW 6 130,102,123 (GRCm39) missense probably benign 0.03
R7009:Klra8 UTSW 6 130,102,147 (GRCm39) missense probably benign 0.02
R8443:Klra8 UTSW 6 130,105,056 (GRCm39) missense probably damaging 0.98
X0013:Klra8 UTSW 6 130,102,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCCATAGAAAATTGGGAAAACC -3'
(R):5'- TCATGAACCGAGGACACTTGAAG -3'

Sequencing Primer
(F):5'- CATGAGAAATGGAGAAAAGCCTTTTC -3'
(R):5'- ATGATGAGACTGAGTGGTG -3'
Posted On 2021-11-19