Incidental Mutation 'R9055:Mettl4'
ID 688655
Institutional Source Beutler Lab
Gene Symbol Mettl4
Ensembl Gene ENSMUSG00000055660
Gene Name methyltransferase like 4
Synonyms HsT661, A730091E08Rik, 2410198H06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9055 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 94727080-94749892 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94740415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 266 (D266G)
Ref Sequence ENSEMBL: ENSMUSP00000127142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171284]
AlphaFold Q3U034
Predicted Effect possibly damaging
Transcript: ENSMUST00000171284
AA Change: D266G

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127142
Gene: ENSMUSG00000055660
AA Change: D266G

DomainStartEndE-ValueType
Pfam:MT-A70 280 454 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,041,966 T753S probably benign Het
Acy3 A G 19: 3,988,178 E157G probably benign Het
Adamts20 A G 15: 94,283,986 Y1609H probably damaging Het
Ahnak2 C T 12: 112,774,585 A1018T possibly damaging Het
Ahsg T A 16: 22,892,319 W69R possibly damaging Het
Alox12 T G 11: 70,253,077 D159A probably damaging Het
Alox12b C G 11: 69,164,058 P296A possibly damaging Het
Ankrd17 T C 5: 90,232,309 I2507V probably benign Het
Apeh T C 9: 108,085,846 M670V possibly damaging Het
Aqp12 C T 1: 93,006,905 A168V probably benign Het
BC030499 A G 11: 78,293,547 D240G probably damaging Het
Ceacam1 A T 7: 25,471,874 D388E probably damaging Het
Clp1 A T 2: 84,723,922 I301N probably damaging Het
Cntn3 A G 6: 102,267,437 F384L probably benign Het
Dnpep A T 1: 75,315,161 M238K possibly damaging Het
Edc3 T A 9: 57,716,077 N98K probably benign Het
Egr3 T A 14: 70,078,900 N15K probably damaging Het
Fbxo25 T A 8: 13,915,023 C25S possibly damaging Het
Fgd4 T A 16: 16,422,630 D745V possibly damaging Het
Flnb T A 14: 7,908,553 D1310E probably benign Het
Ggnbp2 A G 11: 84,841,622 F215S probably damaging Het
Gm1979 C T 5: 26,002,034 R107Q probably benign Het
Gm4847 T A 1: 166,640,108 H173L probably damaging Het
Gmeb1 A T 4: 132,237,114 L146H probably damaging Het
Gpr88 A G 3: 116,252,651 S4P unknown Het
Gucy1a1 A G 3: 82,109,126 L185P possibly damaging Het
Hsd3b6 G T 3: 98,806,668 T105N probably damaging Het
Iqca T C 1: 90,070,613 Y546C probably benign Het
Irf1 T A 11: 53,776,370 I305N probably benign Het
Itgb3 G A 11: 104,665,625 W764* probably null Het
Klra8 G T 6: 130,119,054 R192S probably benign Het
Krt79 T A 15: 101,931,487 I358F probably damaging Het
Mfsd8 G A 3: 40,832,058 A219V probably benign Het
Nek9 A T 12: 85,301,842 C973S probably damaging Het
Olfr1309 A T 2: 111,983,704 Y123* probably null Het
Olfr267 G T 4: 58,785,374 A116E possibly damaging Het
Olfr891 T C 9: 38,180,484 Y113C probably damaging Het
Ostc T A 3: 130,709,371 E2V probably damaging Het
Ostc C A 3: 130,709,372 E2* probably null Het
Pcdhb8 T A 18: 37,357,532 C754* probably null Het
Polr1a A G 6: 71,915,069 T111A possibly damaging Het
Prep C T 10: 45,115,195 T319M probably benign Het
Reg3b A C 6: 78,372,903 D142A possibly damaging Het
Retsat A G 6: 72,606,953 D537G probably benign Het
Rnf2 G A 1: 151,476,279 L109F probably damaging Het
Runx3 G T 4: 135,175,345 R262L probably damaging Het
Rwdd3 G T 3: 121,159,222 T112K probably benign Het
Scfd2 T C 5: 74,531,270 H117R possibly damaging Het
Scn10a C T 9: 119,622,892 V1321M probably damaging Het
Sec31a T C 5: 100,386,181 E119G possibly damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slc18a1 T A 8: 69,068,171 I199F possibly damaging Het
St18 C T 1: 6,802,982 R314* probably null Het
Sulf1 A T 1: 12,807,963 H225L probably damaging Het
Tas2r140 A G 6: 133,055,417 V126A possibly damaging Het
Tcp10b T C 17: 13,062,941 I66T probably damaging Het
Tmem45a2 T C 16: 57,040,752 I237M probably benign Het
Traf3ip1 C T 1: 91,501,011 R167* probably null Het
Trav17 T G 14: 53,806,863 V30G probably damaging Het
Vmn1r54 A G 6: 90,269,118 N5D probably benign Het
Vmn2r81 A G 10: 79,274,607 H518R probably benign Het
Washc3 A G 10: 88,216,054 T102A probably benign Het
Xaf1 A G 11: 72,303,440 H49R probably damaging Het
Zfp276 T C 8: 123,258,370 F356L probably damaging Het
Zfp398 G T 6: 47,866,385 R457L possibly damaging Het
Zfp512 G T 5: 31,480,189 E541* probably null Het
Other mutations in Mettl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Mettl4 APN 17 94735371 missense probably damaging 1.00
R1938:Mettl4 UTSW 17 94747857 missense possibly damaging 0.76
R2172:Mettl4 UTSW 17 94733163 missense probably benign
R2370:Mettl4 UTSW 17 94733148 missense probably damaging 1.00
R3621:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
R3913:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R4155:Mettl4 UTSW 17 94740575 missense probably benign
R4536:Mettl4 UTSW 17 94735505 missense possibly damaging 0.79
R4946:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R5263:Mettl4 UTSW 17 94740509 nonsense probably null
R5397:Mettl4 UTSW 17 94727277 nonsense probably null
R6242:Mettl4 UTSW 17 94735374 missense probably damaging 1.00
R6508:Mettl4 UTSW 17 94743945 missense probably damaging 0.98
R7069:Mettl4 UTSW 17 94733633 missense probably damaging 0.98
R7941:Mettl4 UTSW 17 94733194 splice site probably null
R8088:Mettl4 UTSW 17 94735367 missense probably damaging 1.00
R8373:Mettl4 UTSW 17 94733649 missense probably damaging 1.00
R8710:Mettl4 UTSW 17 94733644 missense probably damaging 0.99
R9130:Mettl4 UTSW 17 94735485 missense possibly damaging 0.61
R9335:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
Z1176:Mettl4 UTSW 17 94733563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAGTCTGAACCTCTCAATTCTG -3'
(R):5'- GCCTTCCTTAAATGAAATGGAGCTTC -3'

Sequencing Primer
(F):5'- TGAGATGCCAAGGCTATCCTG -3'
(R):5'- CTTCAAACGCTACAGTTGATGGG -3'
Posted On 2021-11-19