Mutagenetix > Incidental Mutation

Incidental Mutation 'R9056:Vmn2r68'

688690

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R9056 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85222212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 621 (V621A)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061074
AA Change: V621A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: V621A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	G	A	1: 37,624,472	R782C	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,267	T1970A	probably benign	Het
Abca13	T	C	11: 9,464,921	I3996T	probably damaging	Het
Adgra1	A	G	7: 139,852,576	N110S	probably damaging	Het
Arhgap31	T	C	16: 38,606,655	T612A	probably benign	Het
Atp13a4	C	T	16: 29,471,888		probably null	Het
C1rb	T	C	6: 124,577,025	S352P	probably damaging	Het
Cc2d2b	T	C	19: 40,795,772	I671T	unknown	Het
Cmas	A	G	6: 142,764,379	D116G	probably damaging	Het
Col24a1	T	C	3: 145,315,248	V460A	probably damaging	Het
Cubn	T	G	2: 13,456,655	D687A	probably damaging	Het
Cul9	A	C	17: 46,543,770	V2G	probably damaging	Het
Elp3	T	C	14: 65,560,133	Y382C	probably damaging	Het
Fbxo11	A	T	17: 88,002,821	I443K		Het
Fdps	G	A	3: 89,099,332	R84W	probably benign	Het
Helz	C	T	11: 107,656,193	A1112V	possibly damaging	Het
Herc1	T	A	9: 66,473,500	M3553K	probably benign	Het
Hspa12a	T	C	19: 58,825,288	Y135C	probably damaging	Het
Hspa1l	A	G	17: 34,977,873	Y296C	probably benign	Het
Ifna12	T	G	4: 88,602,842	E156A	possibly damaging	Het
Ilf3	C	T	9: 21,403,138	Q689*	probably null	Het
Ints1	A	G	5: 139,774,286		probably null	Het
Itga8	T	A	2: 12,230,208	D413V	possibly damaging	Het
Kcnd3	C	T	3: 105,666,974	L492F	possibly damaging	Het
Kcnh5	T	C	12: 74,898,000	K825R	probably benign	Het
Kcnma1	A	G	14: 23,650,146	I194T	possibly damaging	Het
Kmo	A	G	1: 175,637,542	R30G	probably damaging	Het
Krtap19-4	C	A	16: 88,884,913	G52C	unknown	Het
Ksr1	A	G	11: 79,027,639	V563A	possibly damaging	Het
Lyn	A	T	4: 3,780,925	M355L	possibly damaging	Het
Med13	A	T	11: 86,298,834	L1083*	probably null	Het
Mfsd13a	A	G	19: 46,366,461	T26A	probably benign	Het
Mup14	T	C	4: 61,303,431	I41V	probably benign	Het
Myo9b	T	A	8: 71,352,262	S1466T	probably benign	Het
Nampt	T	C	12: 32,838,459		probably null	Het
Nbeal1	T	C	1: 60,278,726	Y1941H	probably damaging	Het
Nyap2	C	T	1: 81,336,599	A670V	probably benign	Het
Olfr1294	T	C	2: 111,538,143	I49V	probably benign	Het
Olfr171	A	G	16: 19,625,041	S20P	probably benign	Het
Olfr63	A	G	17: 33,268,820	Y32C	probably damaging	Het
Olfr734	T	C	14: 50,320,542	I98V	probably damaging	Het
Olfr949-ps1	T	C	9: 39,365,120	V187A	unknown	Het
Pcdh15	A	G	10: 74,385,899	D677G	probably damaging	Het
Pogz	T	A	3: 94,880,219	S1373T	probably benign	Het
Ptprj	T	C	2: 90,458,269	D691G	probably benign	Het
Qpctl	T	A	7: 19,147,036	D157V	probably damaging	Het
Rbbp8	T	C	18: 11,677,620	F60L	possibly damaging	Het
Ripor1	T	A	8: 105,617,440	L402Q	possibly damaging	Het
Rptn	C	T	3: 93,397,105	H582Y	probably benign	Het
Rusc1	T	A	3: 89,089,683	Q611L	probably damaging	Het
Ryr2	A	G	13: 11,595,931	V4003A	possibly damaging	Het
Siglech	T	A	7: 55,772,546	W300R	probably benign	Het
Slc25a51	T	C	4: 45,399,494	D232G	probably damaging	Het
Slc6a11	T	A	6: 114,243,944	C479S	probably benign	Het
Sspo	G	T	6: 48,473,674	G2599V	probably damaging	Het
Tfpt	T	A	7: 3,624,605	E116V	probably null	Het
Tmem260	T	A	14: 48,480,317	V121E	probably benign	Het
Tmem54	T	C	4: 129,108,327	F45L	probably benign	Het
Trim2	T	A	3: 84,172,821	N631I	probably damaging	Het
Tshr	C	T	12: 91,507,789	T179I	probably damaging	Het
Vmn1r40	A	G	6: 89,714,216	N5S	probably benign	Het
Zc2hc1c	TTTATCC	T	12: 85,296,456		probably benign	Het
Zfp644	G	A	5: 106,636,078	Q837*	probably null	Het
Zfp773	A	T	7: 7,132,990	N202K	probably damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TATTTGGGTGCCCCTGACAC -3'
(R):5'- TGCAAATGAACACCATACTCTCTG -3'

Sequencing Primer
(F):5'- GTGCCCCTGACACAAGCAG -3'
(R):5'- CTGCCTCCAAAAAGTTGTGTC -3'

Posted On

2021-11-19