Incidental Mutation 'R9056:Vmn2r68'
ID 688690
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms Vmn2r68-ps, EG620697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9056 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85221518-85237704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85222212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 621 (V621A)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect possibly damaging
Transcript: ENSMUST00000061074
AA Change: V621A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: V621A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,624,472 R782C possibly damaging Het
4932415D10Rik T C 10: 82,291,267 T1970A probably benign Het
Abca13 T C 11: 9,464,921 I3996T probably damaging Het
Adgra1 A G 7: 139,852,576 N110S probably damaging Het
Arhgap31 T C 16: 38,606,655 T612A probably benign Het
Atp13a4 C T 16: 29,471,888 probably null Het
C1rb T C 6: 124,577,025 S352P probably damaging Het
Cc2d2b T C 19: 40,795,772 I671T unknown Het
Cmas A G 6: 142,764,379 D116G probably damaging Het
Col24a1 T C 3: 145,315,248 V460A probably damaging Het
Cubn T G 2: 13,456,655 D687A probably damaging Het
Cul9 A C 17: 46,543,770 V2G probably damaging Het
Elp3 T C 14: 65,560,133 Y382C probably damaging Het
Fbxo11 A T 17: 88,002,821 I443K Het
Fdps G A 3: 89,099,332 R84W probably benign Het
Helz C T 11: 107,656,193 A1112V possibly damaging Het
Herc1 T A 9: 66,473,500 M3553K probably benign Het
Hspa12a T C 19: 58,825,288 Y135C probably damaging Het
Hspa1l A G 17: 34,977,873 Y296C probably benign Het
Ifna12 T G 4: 88,602,842 E156A possibly damaging Het
Ilf3 C T 9: 21,403,138 Q689* probably null Het
Ints1 A G 5: 139,774,286 probably null Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Kcnd3 C T 3: 105,666,974 L492F possibly damaging Het
Kcnh5 T C 12: 74,898,000 K825R probably benign Het
Kcnma1 A G 14: 23,650,146 I194T possibly damaging Het
Kmo A G 1: 175,637,542 R30G probably damaging Het
Krtap19-4 C A 16: 88,884,913 G52C unknown Het
Ksr1 A G 11: 79,027,639 V563A possibly damaging Het
Lyn A T 4: 3,780,925 M355L possibly damaging Het
Med13 A T 11: 86,298,834 L1083* probably null Het
Mfsd13a A G 19: 46,366,461 T26A probably benign Het
Mup14 T C 4: 61,303,431 I41V probably benign Het
Myo9b T A 8: 71,352,262 S1466T probably benign Het
Nampt T C 12: 32,838,459 probably null Het
Nbeal1 T C 1: 60,278,726 Y1941H probably damaging Het
Nyap2 C T 1: 81,336,599 A670V probably benign Het
Olfr1294 T C 2: 111,538,143 I49V probably benign Het
Olfr171 A G 16: 19,625,041 S20P probably benign Het
Olfr63 A G 17: 33,268,820 Y32C probably damaging Het
Olfr734 T C 14: 50,320,542 I98V probably damaging Het
Olfr949-ps1 T C 9: 39,365,120 V187A unknown Het
Pcdh15 A G 10: 74,385,899 D677G probably damaging Het
Pogz T A 3: 94,880,219 S1373T probably benign Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qpctl T A 7: 19,147,036 D157V probably damaging Het
Rbbp8 T C 18: 11,677,620 F60L possibly damaging Het
Ripor1 T A 8: 105,617,440 L402Q possibly damaging Het
Rptn C T 3: 93,397,105 H582Y probably benign Het
Rusc1 T A 3: 89,089,683 Q611L probably damaging Het
Ryr2 A G 13: 11,595,931 V4003A possibly damaging Het
Siglech T A 7: 55,772,546 W300R probably benign Het
Slc25a51 T C 4: 45,399,494 D232G probably damaging Het
Slc6a11 T A 6: 114,243,944 C479S probably benign Het
Sspo G T 6: 48,473,674 G2599V probably damaging Het
Tfpt T A 7: 3,624,605 E116V probably null Het
Tmem260 T A 14: 48,480,317 V121E probably benign Het
Tmem54 T C 4: 129,108,327 F45L probably benign Het
Trim2 T A 3: 84,172,821 N631I probably damaging Het
Tshr C T 12: 91,507,789 T179I probably damaging Het
Vmn1r40 A G 6: 89,714,216 N5S probably benign Het
Zc2hc1c TTTATCC T 12: 85,296,456 probably benign Het
Zfp644 G A 5: 106,636,078 Q837* probably null Het
Zfp773 A T 7: 7,132,990 N202K probably damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 85222113 missense possibly damaging 0.68
R9342:Vmn2r68 UTSW 7 85233785 missense probably benign 0.39
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATTTGGGTGCCCCTGACAC -3'
(R):5'- TGCAAATGAACACCATACTCTCTG -3'

Sequencing Primer
(F):5'- GTGCCCCTGACACAAGCAG -3'
(R):5'- CTGCCTCCAAAAAGTTGTGTC -3'
Posted On 2021-11-19