Incidental Mutation 'R9056:Tmem260'
ID 688709
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Name transmembrane protein 260
Synonyms 6720456H20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9056 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 48446124-48524246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48480317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 121 (V121E)
Ref Sequence ENSEMBL: ENSMUSP00000118376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440] [ENSMUST00000228697]
AlphaFold Q8BMD6
Predicted Effect probably benign
Transcript: ENSMUST00000111735
AA Change: V273E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: V273E

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124720
AA Change: V121E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: V121E

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226422
AA Change: V273E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227440
AA Change: V273E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000228697
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,624,472 R782C possibly damaging Het
4932415D10Rik T C 10: 82,291,267 T1970A probably benign Het
Abca13 T C 11: 9,464,921 I3996T probably damaging Het
Adgra1 A G 7: 139,852,576 N110S probably damaging Het
Arhgap31 T C 16: 38,606,655 T612A probably benign Het
Atp13a4 C T 16: 29,471,888 probably null Het
C1rb T C 6: 124,577,025 S352P probably damaging Het
Cc2d2b T C 19: 40,795,772 I671T unknown Het
Cmas A G 6: 142,764,379 D116G probably damaging Het
Col24a1 T C 3: 145,315,248 V460A probably damaging Het
Cubn T G 2: 13,456,655 D687A probably damaging Het
Cul9 A C 17: 46,543,770 V2G probably damaging Het
Elp3 T C 14: 65,560,133 Y382C probably damaging Het
Fbxo11 A T 17: 88,002,821 I443K Het
Fdps G A 3: 89,099,332 R84W probably benign Het
Helz C T 11: 107,656,193 A1112V possibly damaging Het
Herc1 T A 9: 66,473,500 M3553K probably benign Het
Hspa12a T C 19: 58,825,288 Y135C probably damaging Het
Hspa1l A G 17: 34,977,873 Y296C probably benign Het
Ifna12 T G 4: 88,602,842 E156A possibly damaging Het
Ilf3 C T 9: 21,403,138 Q689* probably null Het
Ints1 A G 5: 139,774,286 probably null Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Kcnd3 C T 3: 105,666,974 L492F possibly damaging Het
Kcnh5 T C 12: 74,898,000 K825R probably benign Het
Kcnma1 A G 14: 23,650,146 I194T possibly damaging Het
Kmo A G 1: 175,637,542 R30G probably damaging Het
Krtap19-4 C A 16: 88,884,913 G52C unknown Het
Ksr1 A G 11: 79,027,639 V563A possibly damaging Het
Lyn A T 4: 3,780,925 M355L possibly damaging Het
Med13 A T 11: 86,298,834 L1083* probably null Het
Mfsd13a A G 19: 46,366,461 T26A probably benign Het
Mup14 T C 4: 61,303,431 I41V probably benign Het
Myo9b T A 8: 71,352,262 S1466T probably benign Het
Nampt T C 12: 32,838,459 probably null Het
Nbeal1 T C 1: 60,278,726 Y1941H probably damaging Het
Nyap2 C T 1: 81,336,599 A670V probably benign Het
Olfr1294 T C 2: 111,538,143 I49V probably benign Het
Olfr171 A G 16: 19,625,041 S20P probably benign Het
Olfr63 A G 17: 33,268,820 Y32C probably damaging Het
Olfr734 T C 14: 50,320,542 I98V probably damaging Het
Olfr949-ps1 T C 9: 39,365,120 V187A unknown Het
Pcdh15 A G 10: 74,385,899 D677G probably damaging Het
Pogz T A 3: 94,880,219 S1373T probably benign Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qpctl T A 7: 19,147,036 D157V probably damaging Het
Rbbp8 T C 18: 11,677,620 F60L possibly damaging Het
Ripor1 T A 8: 105,617,440 L402Q possibly damaging Het
Rptn C T 3: 93,397,105 H582Y probably benign Het
Rusc1 T A 3: 89,089,683 Q611L probably damaging Het
Ryr2 A G 13: 11,595,931 V4003A possibly damaging Het
Siglech T A 7: 55,772,546 W300R probably benign Het
Slc25a51 T C 4: 45,399,494 D232G probably damaging Het
Slc6a11 T A 6: 114,243,944 C479S probably benign Het
Sspo G T 6: 48,473,674 G2599V probably damaging Het
Tfpt T A 7: 3,624,605 E116V probably null Het
Tmem54 T C 4: 129,108,327 F45L probably benign Het
Trim2 T A 3: 84,172,821 N631I probably damaging Het
Tshr C T 12: 91,507,789 T179I probably damaging Het
Vmn1r40 A G 6: 89,714,216 N5S probably benign Het
Vmn2r68 A G 7: 85,222,212 V621A possibly damaging Het
Zc2hc1c TTTATCC T 12: 85,296,456 probably benign Het
Zfp644 G A 5: 106,636,078 Q837* probably null Het
Zfp773 A T 7: 7,132,990 N202K probably damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5189:Tmem260 UTSW 14 48509116 missense probably benign 0.01
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 splice site probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 splice site probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 splice site probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R8795:Tmem260 UTSW 14 48451913 missense probably damaging 1.00
R8895:Tmem260 UTSW 14 48500388 unclassified probably benign
R9096:Tmem260 UTSW 14 48520346 missense unknown
R9384:Tmem260 UTSW 14 48486819 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTATCCTAAAAGCTTCCTAGTGGG -3'
(R):5'- TGGAAAGCTAAAGCACTTGGC -3'

Sequencing Primer
(F):5'- AAGCTTCCTAGTGGGTGCCTAAAG -3'
(R):5'- CACTTGGCAATACAGTGTGC -3'
Posted On 2021-11-19