Incidental Mutation 'R9056:Atp13a4'
ID 688713
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9056 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 29471888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000057018
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182627
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,624,472 R782C possibly damaging Het
4932415D10Rik T C 10: 82,291,267 T1970A probably benign Het
Abca13 T C 11: 9,464,921 I3996T probably damaging Het
Adgra1 A G 7: 139,852,576 N110S probably damaging Het
Arhgap31 T C 16: 38,606,655 T612A probably benign Het
C1rb T C 6: 124,577,025 S352P probably damaging Het
Cc2d2b T C 19: 40,795,772 I671T unknown Het
Cmas A G 6: 142,764,379 D116G probably damaging Het
Col24a1 T C 3: 145,315,248 V460A probably damaging Het
Cubn T G 2: 13,456,655 D687A probably damaging Het
Cul9 A C 17: 46,543,770 V2G probably damaging Het
Elp3 T C 14: 65,560,133 Y382C probably damaging Het
Fbxo11 A T 17: 88,002,821 I443K Het
Fdps G A 3: 89,099,332 R84W probably benign Het
Helz C T 11: 107,656,193 A1112V possibly damaging Het
Herc1 T A 9: 66,473,500 M3553K probably benign Het
Hspa12a T C 19: 58,825,288 Y135C probably damaging Het
Hspa1l A G 17: 34,977,873 Y296C probably benign Het
Ifna12 T G 4: 88,602,842 E156A possibly damaging Het
Ilf3 C T 9: 21,403,138 Q689* probably null Het
Ints1 A G 5: 139,774,286 probably null Het
Itga8 T A 2: 12,230,208 D413V possibly damaging Het
Kcnd3 C T 3: 105,666,974 L492F possibly damaging Het
Kcnh5 T C 12: 74,898,000 K825R probably benign Het
Kcnma1 A G 14: 23,650,146 I194T possibly damaging Het
Kmo A G 1: 175,637,542 R30G probably damaging Het
Krtap19-4 C A 16: 88,884,913 G52C unknown Het
Ksr1 A G 11: 79,027,639 V563A possibly damaging Het
Lyn A T 4: 3,780,925 M355L possibly damaging Het
Med13 A T 11: 86,298,834 L1083* probably null Het
Mfsd13a A G 19: 46,366,461 T26A probably benign Het
Mup14 T C 4: 61,303,431 I41V probably benign Het
Myo9b T A 8: 71,352,262 S1466T probably benign Het
Nampt T C 12: 32,838,459 probably null Het
Nbeal1 T C 1: 60,278,726 Y1941H probably damaging Het
Nyap2 C T 1: 81,336,599 A670V probably benign Het
Olfr1294 T C 2: 111,538,143 I49V probably benign Het
Olfr171 A G 16: 19,625,041 S20P probably benign Het
Olfr63 A G 17: 33,268,820 Y32C probably damaging Het
Olfr734 T C 14: 50,320,542 I98V probably damaging Het
Olfr949-ps1 T C 9: 39,365,120 V187A unknown Het
Pcdh15 A G 10: 74,385,899 D677G probably damaging Het
Pogz T A 3: 94,880,219 S1373T probably benign Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qpctl T A 7: 19,147,036 D157V probably damaging Het
Rbbp8 T C 18: 11,677,620 F60L possibly damaging Het
Ripor1 T A 8: 105,617,440 L402Q possibly damaging Het
Rptn C T 3: 93,397,105 H582Y probably benign Het
Rusc1 T A 3: 89,089,683 Q611L probably damaging Het
Ryr2 A G 13: 11,595,931 V4003A possibly damaging Het
Siglech T A 7: 55,772,546 W300R probably benign Het
Slc25a51 T C 4: 45,399,494 D232G probably damaging Het
Slc6a11 T A 6: 114,243,944 C479S probably benign Het
Sspo G T 6: 48,473,674 G2599V probably damaging Het
Tfpt T A 7: 3,624,605 E116V probably null Het
Tmem260 T A 14: 48,480,317 V121E probably benign Het
Tmem54 T C 4: 129,108,327 F45L probably benign Het
Trim2 T A 3: 84,172,821 N631I probably damaging Het
Tshr C T 12: 91,507,789 T179I probably damaging Het
Vmn1r40 A G 6: 89,714,216 N5S probably benign Het
Vmn2r68 A G 7: 85,222,212 V621A possibly damaging Het
Zc2hc1c TTTATCC T 12: 85,296,456 probably benign Het
Zfp644 G A 5: 106,636,078 Q837* probably null Het
Zfp773 A T 7: 7,132,990 N202K probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9622:Atp13a4 UTSW 16 29420459 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- GGTCAAGGAACCCCTAGTAAGC -3'
(R):5'- CATGTGTCAAGCCCAAAAGC -3'

Sequencing Primer
(F):5'- AGAGGATCCTCCATCTTCTGAAGG -3'
(R):5'- TGTCAAGCCCAAAAGCCATTCTTG -3'
Posted On 2021-11-19