Incidental Mutation 'R9057:Golga3'
ID 688736
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110184599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 133 (T133M)
Ref Sequence ENSEMBL: ENSMUSP00000031477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512] [ENSMUST00000139611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031477
AA Change: T133M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: T133M

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,441,572 D1324N probably benign Het
Acat1 C T 9: 53,592,000 G180R probably damaging Het
AI837181 A C 19: 5,426,702 T298P probably damaging Het
Alms1 T A 6: 85,609,832 D556E unknown Het
Ankle1 T A 8: 71,406,317 W65R probably benign Het
Ano5 A G 7: 51,553,906 N234S probably benign Het
Atad2b T A 12: 5,018,102 C1033* probably null Het
B4galnt1 A G 10: 127,171,130 D452G probably damaging Het
B4gat1 G T 19: 5,039,028 A18S possibly damaging Het
Bard1 A G 1: 71,030,648 Y724H probably damaging Het
BC037034 A T 5: 138,262,687 V232E probably damaging Het
Bcl9 A T 3: 97,204,990 M1383K possibly damaging Het
Ces2f C A 8: 104,948,112 H49N probably benign Het
Col17a1 A T 19: 47,649,083 D1245E probably damaging Het
Col19a1 G T 1: 24,510,881 H312N unknown Het
Cyb5d2 C T 11: 72,789,098 E124K probably benign Het
Dnah5 C T 15: 28,390,868 A3291V probably damaging Het
Exo5 A T 4: 120,921,989 D226E probably damaging Het
Ggt6 C T 11: 72,437,241 T189M probably damaging Het
Gm156 T A 6: 129,775,840 M1L probably benign Het
Gm5592 C A 7: 41,289,463 S723Y possibly damaging Het
Heatr5a C T 12: 51,939,637 E598K probably damaging Het
Hfe T A 13: 23,705,675 I330F possibly damaging Het
Htt A G 5: 34,852,110 I1478M possibly damaging Het
Igf1r T C 7: 68,183,438 F449L probably damaging Het
Ints4 T C 7: 97,509,780 V453A possibly damaging Het
Ints6 A G 14: 62,714,291 probably null Het
Kpna4 G A 3: 69,094,685 T248M probably damaging Het
Lactb T C 9: 66,967,695 I372V possibly damaging Het
Mib1 T A 18: 10,795,728 D696E possibly damaging Het
Mpzl3 G A 9: 45,068,294 R181Q probably damaging Het
Mup12 A T 4: 60,740,780 I33N probably damaging Het
Myh10 A G 11: 68,765,185 I502V possibly damaging Het
Nacad C A 11: 6,600,876 V772F possibly damaging Het
Nbeal2 G T 9: 110,627,150 T2417N probably benign Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Olfr49 T C 14: 54,282,691 E68G probably damaging Het
Olfr699 A T 7: 106,790,089 V304D probably damaging Het
Pan2 A T 10: 128,320,272 H1133L probably damaging Het
Pgk2 A G 17: 40,207,844 V231A possibly damaging Het
Psmd12 G A 11: 107,486,502 R129Q probably null Het
Rpl23a G A 11: 78,181,195 R139C probably benign Het
Sars2 G T 7: 28,746,821 Q158H Het
Scd3 C T 19: 44,235,901 P191L probably damaging Het
Serac1 C A 17: 6,061,615 S262I probably damaging Het
Sh3bp1 A G 15: 78,910,009 T526A probably benign Het
Slc26a3 A T 12: 31,470,959 T721S probably benign Het
Slc8a1 A C 17: 81,648,050 S520A probably benign Het
Sp9 A T 2: 73,273,269 S56C probably damaging Het
Syne2 T G 12: 75,890,393 L255R probably damaging Het
Tcp11l1 A G 2: 104,697,681 I156T probably damaging Het
Tnrc6b G A 15: 80,879,148 A284T probably benign Het
Tsc1 T A 2: 28,685,862 L919H probably damaging Het
Vps13c T A 9: 67,920,927 H1454Q probably benign Het
Vps41 T A 13: 18,843,532 D537E probably benign Het
Wnt16 T A 6: 22,288,824 C47S probably damaging Het
Zfhx2 C T 14: 55,072,570 E840K possibly damaging Het
Zfp61 A T 7: 24,291,277 V483E probably benign Het
Zfp870 A T 17: 32,883,819 S179T probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGATCCCAGACCTTCAGTTG -3'
(R):5'- ACTAGGTGGCAGAAAGTTCC -3'

Sequencing Primer
(F):5'- GTTGTCCCTTGATCCCACAACAAG -3'
(R):5'- TTGCACTCCTTAAAGGGAAGC -3'
Posted On 2021-11-19