Incidental Mutation 'R9057:Atad2b'
ID 688763
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 5018102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1033 (C1033*)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
AA Change: C1033*
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: C1033*

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,441,572 D1324N probably benign Het
Acat1 C T 9: 53,592,000 G180R probably damaging Het
AI837181 A C 19: 5,426,702 T298P probably damaging Het
Alms1 T A 6: 85,609,832 D556E unknown Het
Ankle1 T A 8: 71,406,317 W65R probably benign Het
Ano5 A G 7: 51,553,906 N234S probably benign Het
B4galnt1 A G 10: 127,171,130 D452G probably damaging Het
B4gat1 G T 19: 5,039,028 A18S possibly damaging Het
Bard1 A G 1: 71,030,648 Y724H probably damaging Het
BC037034 A T 5: 138,262,687 V232E probably damaging Het
Bcl9 A T 3: 97,204,990 M1383K possibly damaging Het
Ces2f C A 8: 104,948,112 H49N probably benign Het
Col17a1 A T 19: 47,649,083 D1245E probably damaging Het
Col19a1 G T 1: 24,510,881 H312N unknown Het
Cyb5d2 C T 11: 72,789,098 E124K probably benign Het
Dnah5 C T 15: 28,390,868 A3291V probably damaging Het
Exo5 A T 4: 120,921,989 D226E probably damaging Het
Ggt6 C T 11: 72,437,241 T189M probably damaging Het
Gm156 T A 6: 129,775,840 M1L probably benign Het
Gm5592 C A 7: 41,289,463 S723Y possibly damaging Het
Golga3 C T 5: 110,184,599 T133M probably damaging Het
Heatr5a C T 12: 51,939,637 E598K probably damaging Het
Hfe T A 13: 23,705,675 I330F possibly damaging Het
Htt A G 5: 34,852,110 I1478M possibly damaging Het
Igf1r T C 7: 68,183,438 F449L probably damaging Het
Ints4 T C 7: 97,509,780 V453A possibly damaging Het
Ints6 A G 14: 62,714,291 probably null Het
Kpna4 G A 3: 69,094,685 T248M probably damaging Het
Lactb T C 9: 66,967,695 I372V possibly damaging Het
Mib1 T A 18: 10,795,728 D696E possibly damaging Het
Mpzl3 G A 9: 45,068,294 R181Q probably damaging Het
Mup12 A T 4: 60,740,780 I33N probably damaging Het
Myh10 A G 11: 68,765,185 I502V possibly damaging Het
Nacad C A 11: 6,600,876 V772F possibly damaging Het
Nbeal2 G T 9: 110,627,150 T2417N probably benign Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Olfr49 T C 14: 54,282,691 E68G probably damaging Het
Olfr699 A T 7: 106,790,089 V304D probably damaging Het
Pan2 A T 10: 128,320,272 H1133L probably damaging Het
Pgk2 A G 17: 40,207,844 V231A possibly damaging Het
Psmd12 G A 11: 107,486,502 R129Q probably null Het
Rpl23a G A 11: 78,181,195 R139C probably benign Het
Sars2 G T 7: 28,746,821 Q158H Het
Scd3 C T 19: 44,235,901 P191L probably damaging Het
Serac1 C A 17: 6,061,615 S262I probably damaging Het
Sh3bp1 A G 15: 78,910,009 T526A probably benign Het
Slc26a3 A T 12: 31,470,959 T721S probably benign Het
Slc8a1 A C 17: 81,648,050 S520A probably benign Het
Sp9 A T 2: 73,273,269 S56C probably damaging Het
Syne2 T G 12: 75,890,393 L255R probably damaging Het
Tcp11l1 A G 2: 104,697,681 I156T probably damaging Het
Tnrc6b G A 15: 80,879,148 A284T probably benign Het
Tsc1 T A 2: 28,685,862 L919H probably damaging Het
Vps13c T A 9: 67,920,927 H1454Q probably benign Het
Vps41 T A 13: 18,843,532 D537E probably benign Het
Wnt16 T A 6: 22,288,824 C47S probably damaging Het
Zfhx2 C T 14: 55,072,570 E840K possibly damaging Het
Zfp61 A T 7: 24,291,277 V483E probably benign Het
Zfp870 A T 17: 32,883,819 S179T probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTAACTTTAGTGGAATAAGCAGC -3'
(R):5'- ACGGTGCCTAGAAATGCAGG -3'

Sequencing Primer
(F):5'- GGTTTTATGACGCAAAGCATATGC -3'
(R):5'- CAGGACGTTCCGAATTAAGCCTG -3'
Posted On 2021-11-19