Incidental Mutation 'R9057:Serac1'
ID 688775
Institutional Source Beutler Lab
Gene Symbol Serac1
Ensembl Gene ENSMUSG00000015659
Gene Name serine active site containing 1
Synonyms 4930511N22Rik, D17Ertd141e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9057 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 6042196-6079741 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 6061615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 262 (S262I)
Ref Sequence ENSEMBL: ENSMUSP00000095043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]
AlphaFold Q3U213
Predicted Effect probably damaging
Transcript: ENSMUST00000024570
AA Change: S232I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: S232I

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097432
AA Change: S262I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: S262I

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,500 probably benign Het
Abca2 G A 2: 25,441,572 D1324N probably benign Het
Acat1 C T 9: 53,592,000 G180R probably damaging Het
AI837181 A C 19: 5,426,702 T298P probably damaging Het
Alms1 T A 6: 85,609,832 D556E unknown Het
Ankle1 T A 8: 71,406,317 W65R probably benign Het
Ano5 A G 7: 51,553,906 N234S probably benign Het
Asb7 T A 7: 66,659,647 probably benign Het
Atad2b T A 12: 5,018,102 C1033* probably null Het
B4galnt1 A G 10: 127,171,130 D452G probably damaging Het
B4gat1 G T 19: 5,039,028 A18S possibly damaging Het
Bard1 A G 1: 71,030,648 Y724H probably damaging Het
BC037034 A T 5: 138,262,687 V232E probably damaging Het
Bcl9 A T 3: 97,204,990 M1383K possibly damaging Het
Cenpt C A 8: 105,849,773 *43L probably null Het
Ces2f C A 8: 104,948,112 H49N probably benign Het
Col17a1 A T 19: 47,649,083 D1245E probably damaging Het
Col19a1 G T 1: 24,510,881 H312N unknown Het
Cyb5d2 C T 11: 72,789,098 E124K probably benign Het
Dnah5 C T 15: 28,390,868 A3291V probably damaging Het
Exo5 A T 4: 120,921,989 D226E probably damaging Het
Ggt6 C T 11: 72,437,241 T189M probably damaging Het
Gm156 T A 6: 129,775,840 M1L probably benign Het
Gm5592 C A 7: 41,289,463 S723Y possibly damaging Het
Golga3 C T 5: 110,184,599 T133M probably damaging Het
Heatr5a C T 12: 51,939,637 E598K probably damaging Het
Hfe T A 13: 23,705,675 I330F possibly damaging Het
Htt A G 5: 34,852,110 I1478M possibly damaging Het
Igf1r T C 7: 68,183,438 F449L probably damaging Het
Ints4 T C 7: 97,509,780 V453A possibly damaging Het
Ints6 A G 14: 62,714,291 probably null Het
Kpna4 G A 3: 69,094,685 T248M probably damaging Het
Lactb T C 9: 66,967,695 I372V possibly damaging Het
Mib1 T A 18: 10,795,728 D696E possibly damaging Het
Mpzl3 G A 9: 45,068,294 R181Q probably damaging Het
Mup12 A T 4: 60,740,780 I33N probably damaging Het
Myh10 A G 11: 68,765,185 I502V possibly damaging Het
Nacad C A 11: 6,600,876 V772F possibly damaging Het
Nbeal2 G T 9: 110,627,150 T2417N probably benign Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Olfr49 T C 14: 54,282,691 E68G probably damaging Het
Olfr699 A T 7: 106,790,089 V304D probably damaging Het
Pan2 A T 10: 128,320,272 H1133L probably damaging Het
Pgk2 A G 17: 40,207,844 V231A possibly damaging Het
Psmd12 G A 11: 107,486,502 R129Q probably null Het
Rpl23a G A 11: 78,181,195 R139C probably benign Het
Sars2 G T 7: 28,746,821 Q158H Het
Scd3 C T 19: 44,235,901 P191L probably damaging Het
Sh3bp1 A G 15: 78,910,009 T526A probably benign Het
Slc26a3 A T 12: 31,470,959 T721S probably benign Het
Slc8a1 A C 17: 81,648,050 S520A probably benign Het
Sp9 A T 2: 73,273,269 S56C probably damaging Het
Spire2 T A 8: 123,368,808 probably benign Het
Syne2 T G 12: 75,890,393 L255R probably damaging Het
Tcp11l1 A G 2: 104,697,681 I156T probably damaging Het
Tnrc6b G A 15: 80,879,148 A284T probably benign Het
Tsc1 T A 2: 28,685,862 L919H probably damaging Het
Vps13c T A 9: 67,920,927 H1454Q probably benign Het
Vps41 T A 13: 18,843,532 D537E probably benign Het
Wnt16 T A 6: 22,288,824 C47S probably damaging Het
Zfhx2 C T 14: 55,072,570 E840K possibly damaging Het
Zfp61 A T 7: 24,291,277 V483E probably benign Het
Zfp870 A T 17: 32,883,819 S179T probably benign Het
Other mutations in Serac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Serac1 APN 17 6074253 splice site probably benign
IGL02642:Serac1 APN 17 6045746 missense possibly damaging 0.56
IGL02972:Serac1 APN 17 6070764 nonsense probably null
FR4304:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4340:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4342:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4589:Serac1 UTSW 17 6070808 missense probably damaging 1.00
PIT4480001:Serac1 UTSW 17 6050812 missense probably damaging 1.00
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0127:Serac1 UTSW 17 6048840 missense probably damaging 1.00
R0211:Serac1 UTSW 17 6050060 missense possibly damaging 0.67
R0245:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0538:Serac1 UTSW 17 6048826 splice site probably benign
R0652:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0988:Serac1 UTSW 17 6061580 missense probably benign 0.02
R1965:Serac1 UTSW 17 6048999 missense possibly damaging 0.72
R1984:Serac1 UTSW 17 6045689 splice site probably null
R2145:Serac1 UTSW 17 6050785 missense probably damaging 1.00
R3426:Serac1 UTSW 17 6066778 missense probably benign 0.04
R3921:Serac1 UTSW 17 6066792 missense probably damaging 1.00
R4760:Serac1 UTSW 17 6051790 missense possibly damaging 0.69
R4958:Serac1 UTSW 17 6069382 missense probably benign 0.15
R5552:Serac1 UTSW 17 6056692 nonsense probably null
R5874:Serac1 UTSW 17 6043913 unclassified probably benign
R5964:Serac1 UTSW 17 6065049 missense probably benign
R6614:Serac1 UTSW 17 6045662 missense probably damaging 1.00
R6794:Serac1 UTSW 17 6051710 missense probably damaging 1.00
R6949:Serac1 UTSW 17 6051815 missense probably damaging 1.00
R7157:Serac1 UTSW 17 6074201 missense probably benign
R7161:Serac1 UTSW 17 6065076 missense probably damaging 0.97
R7426:Serac1 UTSW 17 6069314 missense probably damaging 1.00
R8270:Serac1 UTSW 17 6050758 missense probably damaging 1.00
R8733:Serac1 UTSW 17 6050028 missense probably damaging 1.00
R8785:Serac1 UTSW 17 6044202 missense probably damaging 0.99
R9657:Serac1 UTSW 17 6069383 missense probably benign 0.04
Z1088:Serac1 UTSW 17 6048918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATGAACTCCTTGTATGTG -3'
(R):5'- CAGACTTGTTTTGGGAATCACTTG -3'

Sequencing Primer
(F):5'- AGTTACAGGGAATCCAGTGTCCTC -3'
(R):5'- GGAATCACTTGGTGTCTTTTCTATTC -3'
Posted On 2021-11-19