Incidental Mutation 'R9058:Dnah7c'
ID 688786
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R9058 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 46766656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 3422 (G3422W)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: G3422W

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: G3422W

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,716,042 N63S probably benign Het
1700007G11Rik A T 5: 98,784,541 D200V probably damaging Het
Acox1 T C 11: 116,189,442 T135A possibly damaging Het
Aldh8a1 T C 10: 21,382,445 I147T possibly damaging Het
Alkbh5 T C 11: 60,553,722 L288S probably benign Het
Arhgap8 A G 15: 84,757,040 N169S probably benign Het
BC030867 T C 11: 102,255,560 S221P probably benign Het
Bpifb5 A G 2: 154,238,897 D478G possibly damaging Het
Cacna1s A T 1: 136,070,698 K155* probably null Het
Ccser1 T C 6: 61,373,992 L511P probably damaging Het
Cebpz A T 17: 78,935,798 N142K probably benign Het
Clip1 G T 5: 123,614,582 R379S Het
Cpne8 T A 15: 90,497,073 I513F probably damaging Het
Ctnnb1 T A 9: 120,951,410 C213* probably null Het
Dnah7b A G 1: 46,243,415 K2903E probably damaging Het
Dnhd1 T A 7: 105,684,063 H247Q probably benign Het
Efna2 A G 10: 80,186,886 Y88C probably damaging Het
Elmsan1 A G 12: 84,173,868 M104T probably damaging Het
Eppk1 C T 15: 76,108,065 G1539R probably benign Het
Exoc3l2 A T 7: 19,469,896 K138* probably null Het
Fam47e A G 5: 92,571,508 probably benign Het
Frmpd1 T A 4: 45,283,948 M923K probably damaging Het
Gbe1 A G 16: 70,527,171 E558G possibly damaging Het
Gm5431 T C 11: 48,895,222 T109A probably benign Het
Gm9508 G A 10: 77,696,786 P150S unknown Het
Gm9774 A T 3: 92,428,252 M283K probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hsfy2 A T 1: 56,637,345 V11D probably benign Het
Kif13a T C 13: 46,791,465 N887D probably damaging Het
Kirrel A G 3: 87,085,135 V541A probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lamc3 G A 2: 31,908,641 R453H probably benign Het
Muc6 G C 7: 141,638,241 T2173S possibly damaging Het
Neb T C 2: 52,185,329 N208S probably benign Het
Nlrc5 A T 8: 94,512,310 T1459S possibly damaging Het
Npy1r T C 8: 66,703,948 S7P probably benign Het
Nr4a2 T C 2: 57,112,243 N66S probably benign Het
Nr5a1 T C 2: 38,694,022 T462A probably damaging Het
Ntng2 A G 2: 29,204,190 C390R probably benign Het
Olfr1198 A C 2: 88,746,686 D67E Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr834 T A 9: 18,988,926 *313R probably null Het
Pecam1 G T 11: 106,699,849 P33Q probably damaging Het
Phc2 T A 4: 128,722,976 F347L probably benign Het
Phldb2 T A 16: 45,772,241 H938L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prkch G T 12: 73,775,534 probably null Het
Puf60 C T 15: 76,070,576 D483N probably benign Het
Puf60 C T 15: 76,072,533 M133I probably benign Het
Rmnd1 T C 10: 4,413,398 H284R probably benign Het
Scaper T C 9: 55,815,478 E682G probably damaging Het
Sds A G 5: 120,480,714 E111G possibly damaging Het
Sec23b T A 2: 144,582,090 I553N probably damaging Het
Serpina1a A T 12: 103,853,742 I415K possibly damaging Het
Slc14a1 T A 18: 78,102,570 probably null Het
Socs1 G A 16: 10,784,828 P15L probably benign Het
Sv2b A T 7: 75,140,074 probably null Het
Sync T C 4: 129,293,424 I83T probably damaging Het
Syt16 T A 12: 74,235,245 L381Q probably damaging Het
Tbx20 T C 9: 24,769,723 R158G probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem19 C A 10: 115,362,126 probably benign Het
Trpa1 A C 1: 14,889,394 N689K probably damaging Het
Ube3b C A 5: 114,415,239 H891N probably benign Het
Vmn2r19 T A 6: 123,336,062 M697K possibly damaging Het
Zfp142 A T 1: 74,569,796 C1613* probably null Het
Zfp7 T A 15: 76,880,781 M1K probably null Het
Zfp936 A T 7: 43,189,772 Q221L probably benign Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATACAGGGGAGTCCAGTTCAC -3'
(R):5'- TCCTGTGGCTGAGTGACAAG -3'

Sequencing Primer
(F):5'- TGGATATGCTAGCACACTCACTG -3'
(R):5'- GTGACAAGGTTTAGTTTTCTCTCATC -3'
Posted On 2021-11-19