Incidental Mutation 'R9058:Ube3b'
ID 688807
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 068884-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9058 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114553300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 891 (H891N)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: H891N

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: H891N

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T C 11: 116,080,268 (GRCm39) T135A possibly damaging Het
Adrm1b A T 3: 92,335,559 (GRCm39) M283K probably benign Het
Aldh8a1 T C 10: 21,258,344 (GRCm39) I147T possibly damaging Het
Alkbh5 T C 11: 60,444,548 (GRCm39) L288S probably benign Het
Bpifb5 A G 2: 154,080,817 (GRCm39) D478G possibly damaging Het
Cacna1s A T 1: 135,998,436 (GRCm39) K155* probably null Het
Ccser1 T C 6: 61,350,976 (GRCm39) L511P probably damaging Het
Cebpz A T 17: 79,243,227 (GRCm39) N142K probably benign Het
Cfap299 A T 5: 98,932,400 (GRCm39) D200V probably damaging Het
Clip1 G T 5: 123,752,645 (GRCm39) R379S Het
Cpne8 T A 15: 90,381,276 (GRCm39) I513F probably damaging Het
Ctnnb1 T A 9: 120,780,476 (GRCm39) C213* probably null Het
Dnah7b A G 1: 46,282,575 (GRCm39) K2903E probably damaging Het
Dnah7c G T 1: 46,805,816 (GRCm39) G3422W probably damaging Het
Dnhd1 T A 7: 105,333,270 (GRCm39) H247Q probably benign Het
Efna2 A G 10: 80,022,720 (GRCm39) Y88C probably damaging Het
Eppk1 C T 15: 75,992,265 (GRCm39) G1539R probably benign Het
Exoc3l2 A T 7: 19,203,821 (GRCm39) K138* probably null Het
Fam47e A G 5: 92,719,367 (GRCm39) probably benign Het
Frmpd1 T A 4: 45,283,948 (GRCm39) M923K probably damaging Het
Gbe1 A G 16: 70,324,059 (GRCm39) E558G possibly damaging Het
Gm5431 T C 11: 48,786,049 (GRCm39) T109A probably benign Het
Gm9508 G A 10: 77,532,620 (GRCm39) P150S unknown Het
Grep1 T C 17: 23,935,016 (GRCm39) N63S probably benign Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hrob T C 11: 102,146,386 (GRCm39) S221P probably benign Het
Hsfy2 A T 1: 56,676,504 (GRCm39) V11D probably benign Het
Kif13a T C 13: 46,944,941 (GRCm39) N887D probably damaging Het
Kirrel1 A G 3: 86,992,442 (GRCm39) V541A probably benign Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Lamc3 G A 2: 31,798,653 (GRCm39) R453H probably benign Het
Mideas A G 12: 84,220,642 (GRCm39) M104T probably damaging Het
Muc6 G C 7: 141,218,154 (GRCm39) T2173S possibly damaging Het
Neb T C 2: 52,075,341 (GRCm39) N208S probably benign Het
Nlrc5 A T 8: 95,238,938 (GRCm39) T1459S possibly damaging Het
Npy1r T C 8: 67,156,600 (GRCm39) S7P probably benign Het
Nr4a2 T C 2: 57,002,255 (GRCm39) N66S probably benign Het
Nr5a1 T C 2: 38,584,034 (GRCm39) T462A probably damaging Het
Ntng2 A G 2: 29,094,202 (GRCm39) C390R probably benign Het
Or4p23 A C 2: 88,577,030 (GRCm39) D67E Het
Or5b119 G A 19: 13,456,956 (GRCm39) T202I possibly damaging Het
Or7g12 T A 9: 18,900,222 (GRCm39) *313R probably null Het
Pecam1 G T 11: 106,590,675 (GRCm39) P33Q probably damaging Het
Phc2 T A 4: 128,616,769 (GRCm39) F347L probably benign Het
Phldb2 T A 16: 45,592,604 (GRCm39) H938L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Prkch G T 12: 73,822,308 (GRCm39) probably null Het
Prr5 A G 15: 84,641,241 (GRCm39) N169S probably benign Het
Puf60 C T 15: 75,942,425 (GRCm39) D483N probably benign Het
Puf60 C T 15: 75,944,382 (GRCm39) M133I probably benign Het
Rmnd1 T C 10: 4,363,398 (GRCm39) H284R probably benign Het
Scaper T C 9: 55,722,762 (GRCm39) E682G probably damaging Het
Sds A G 5: 120,618,779 (GRCm39) E111G possibly damaging Het
Sec23b T A 2: 144,424,010 (GRCm39) I553N probably damaging Het
Serpina1a A T 12: 103,820,001 (GRCm39) I415K possibly damaging Het
Slc14a1 T A 18: 78,145,785 (GRCm39) probably null Het
Socs1 G A 16: 10,602,692 (GRCm39) P15L probably benign Het
Sv2b A T 7: 74,789,822 (GRCm39) probably null Het
Sync T C 4: 129,187,217 (GRCm39) I83T probably damaging Het
Syt16 T A 12: 74,282,019 (GRCm39) L381Q probably damaging Het
Tbx20 T C 9: 24,681,019 (GRCm39) R158G probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmem19 C A 10: 115,198,031 (GRCm39) probably benign Het
Trpa1 A C 1: 14,959,618 (GRCm39) N689K probably damaging Het
Vmn2r19 T A 6: 123,313,021 (GRCm39) M697K possibly damaging Het
Zfp142 A T 1: 74,608,955 (GRCm39) C1613* probably null Het
Zfp7 T A 15: 76,764,981 (GRCm39) M1K probably null Het
Zfp936 A T 7: 42,839,196 (GRCm39) Q221L probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTGGAGATGGTTCGAGAGCAC -3'
(R):5'- GTCACTCTATGTCAGAACCCAAGG -3'

Sequencing Primer
(F):5'- TGGTTCGAGAGCACTAGGC -3'
(R):5'- GATGGCCTAATCATGCCACG -3'
Posted On 2021-11-19