Incidental Mutation 'R9058:Prkch'
ID 688835
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Name protein kinase C, eta
Synonyms Pkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9058 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73584796-73778185 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 73775534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
AlphaFold P23298
Predicted Effect probably null
Transcript: ENSMUST00000021527
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,716,042 N63S probably benign Het
1700007G11Rik A T 5: 98,784,541 D200V probably damaging Het
Acox1 T C 11: 116,189,442 T135A possibly damaging Het
Aldh8a1 T C 10: 21,382,445 I147T possibly damaging Het
Alkbh5 T C 11: 60,553,722 L288S probably benign Het
Arhgap8 A G 15: 84,757,040 N169S probably benign Het
BC030867 T C 11: 102,255,560 S221P probably benign Het
Bpifb5 A G 2: 154,238,897 D478G possibly damaging Het
Cacna1s A T 1: 136,070,698 K155* probably null Het
Ccser1 T C 6: 61,373,992 L511P probably damaging Het
Cebpz A T 17: 78,935,798 N142K probably benign Het
Clip1 G T 5: 123,614,582 R379S Het
Cpne8 T A 15: 90,497,073 I513F probably damaging Het
Ctnnb1 T A 9: 120,951,410 C213* probably null Het
Dnah7b A G 1: 46,243,415 K2903E probably damaging Het
Dnah7c G T 1: 46,766,656 G3422W probably damaging Het
Dnhd1 T A 7: 105,684,063 H247Q probably benign Het
Efna2 A G 10: 80,186,886 Y88C probably damaging Het
Elmsan1 A G 12: 84,173,868 M104T probably damaging Het
Eppk1 C T 15: 76,108,065 G1539R probably benign Het
Exoc3l2 A T 7: 19,469,896 K138* probably null Het
Fam47e A G 5: 92,571,508 probably benign Het
Frmpd1 T A 4: 45,283,948 M923K probably damaging Het
Gbe1 A G 16: 70,527,171 E558G possibly damaging Het
Gm5431 T C 11: 48,895,222 T109A probably benign Het
Gm9508 G A 10: 77,696,786 P150S unknown Het
Gm9774 A T 3: 92,428,252 M283K probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hsfy2 A T 1: 56,637,345 V11D probably benign Het
Kif13a T C 13: 46,791,465 N887D probably damaging Het
Kirrel A G 3: 87,085,135 V541A probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lamc3 G A 2: 31,908,641 R453H probably benign Het
Muc6 G C 7: 141,638,241 T2173S possibly damaging Het
Neb T C 2: 52,185,329 N208S probably benign Het
Nlrc5 A T 8: 94,512,310 T1459S possibly damaging Het
Npy1r T C 8: 66,703,948 S7P probably benign Het
Nr4a2 T C 2: 57,112,243 N66S probably benign Het
Nr5a1 T C 2: 38,694,022 T462A probably damaging Het
Ntng2 A G 2: 29,204,190 C390R probably benign Het
Olfr1198 A C 2: 88,746,686 D67E Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr834 T A 9: 18,988,926 *313R probably null Het
Pecam1 G T 11: 106,699,849 P33Q probably damaging Het
Phc2 T A 4: 128,722,976 F347L probably benign Het
Phldb2 T A 16: 45,772,241 H938L possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Puf60 C T 15: 76,070,576 D483N probably benign Het
Puf60 C T 15: 76,072,533 M133I probably benign Het
Rmnd1 T C 10: 4,413,398 H284R probably benign Het
Scaper T C 9: 55,815,478 E682G probably damaging Het
Sds A G 5: 120,480,714 E111G possibly damaging Het
Sec23b T A 2: 144,582,090 I553N probably damaging Het
Serpina1a A T 12: 103,853,742 I415K possibly damaging Het
Slc14a1 T A 18: 78,102,570 probably null Het
Socs1 G A 16: 10,784,828 P15L probably benign Het
Sv2b A T 7: 75,140,074 probably null Het
Sync T C 4: 129,293,424 I83T probably damaging Het
Syt16 T A 12: 74,235,245 L381Q probably damaging Het
Tbx20 T C 9: 24,769,723 R158G probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem19 C A 10: 115,362,126 probably benign Het
Trpa1 A C 1: 14,889,394 N689K probably damaging Het
Ube3b C A 5: 114,415,239 H891N probably benign Het
Vmn2r19 T A 6: 123,336,062 M697K possibly damaging Het
Zfp142 A T 1: 74,569,796 C1613* probably null Het
Zfp7 T A 15: 76,880,781 M1K probably null Het
Zfp936 A T 7: 43,189,772 Q221L probably benign Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
wolfcreek UTSW 12 73759710 missense probably damaging 1.00
G1Funyon:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
R8734:Prkch UTSW 12 73585244 missense possibly damaging 0.62
R8766:Prkch UTSW 12 73702538 missense probably benign 0.01
R8998:Prkch UTSW 12 73696199 missense probably damaging 1.00
R8999:Prkch UTSW 12 73696199 missense probably damaging 1.00
R9152:Prkch UTSW 12 73691644 missense possibly damaging 0.91
R9176:Prkch UTSW 12 73700194 missense probably damaging 1.00
R9194:Prkch UTSW 12 73721842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCCAGGATGGAAAATC -3'
(R):5'- TTTCAGGGAGGGTAGAGCTAGC -3'

Sequencing Primer
(F):5'- GAATGAATGACGGTCTTTCTCTC -3'
(R):5'- CACAAGTGAGAGGTGAAAACTTTGTG -3'
Posted On 2021-11-19