Mutagenetix > Incidental Mutation

Incidental Mutation 'R9059:Man2b1'

688870

Institutional Source

Beutler Lab

Gene Symbol

Man2b1

Ensembl Gene

ENSMUSG00000005142

Gene Name

mannosidase 2, alpha B1

Synonyms

lysosomal alpha-mannosidase

MMRRC Submission

068885-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85083270-85098282 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85091526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 442 (V442A)

Ref Sequence

ENSEMBL: ENSMUSP00000034121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000209361]

AlphaFold

O09159

Predicted Effect

probably damaging
Transcript: ENSMUST00000034121
AA Change: V442A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: V442A

Domain	Start	End	E-Value	Type
low complexity region	40	51	N/A	INTRINSIC
Pfam:Glyco_hydro_38	64	381	2.7e-96	PFAM
Alpha-mann_mid	386	465	4.25e-23	SMART
Pfam:Glyco_hydro_38C	510	1002	6.2e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209361

Meta Mutation Damage Score

0.6568

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624G23Rik	A	T	12: 24,074,731	D48E	probably benign	Het
Ablim2	A	G	5: 35,802,506	T101A	probably damaging	Het
Acot8	A	G	2: 164,792,909	S316P	probably benign	Het
Acta2	G	T	19: 34,241,755	A349D	possibly damaging	Het
Adgrv1	C	A	13: 81,414,573		probably null	Het
Ankrd55	A	G	13: 112,318,539	D57G	probably damaging	Het
Azin2	A	G	4: 128,934,647	Y351H	probably benign	Het
Ccdc142	T	C	6: 83,102,419	C246R	probably damaging	Het
Col25a1	C	A	3: 130,474,850	Q179K	unknown	Het
Ddx46	C	T	13: 55,652,108	A277V	probably benign	Het
Diaph1	T	A	18: 37,889,745	N792I	possibly damaging	Het
Dnah11	G	A	12: 118,130,843	P830L	probably benign	Het
Dnah3	C	G	7: 120,085,145	R252S	probably benign	Het
Dnah5	A	G	15: 28,245,666	D550G	probably benign	Het
Dph3	T	C	14: 32,085,427	N31D	probably benign	Het
Dsg1c	A	T	18: 20,275,249	T452S	probably damaging	Het
Dsg4	T	A	18: 20,471,125	M883K	possibly damaging	Het
Epn1	T	G	7: 5,095,068	S293A	probably benign	Het
Fggy	T	A	4: 95,800,604	Y318*	probably null	Het
Gm11639	T	C	11: 104,751,863	V1104A	possibly damaging	Het
Hip1	A	G	5: 135,428,743	L703P	probably benign	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Igf2r	GCAGCCCTCCATAGGCGCCAGCCCTCCATAGGCGC	GCAGCCCTCCATAGGCGC	17: 12,751,293		probably null	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Larp4	A	G	15: 99,991,812	E204G	probably benign	Het
Lbr	A	G	1: 181,817,554	I511T		Het
Lingo3	G	T	10: 80,834,689	T469K	probably benign	Het
Lrrc30	A	T	17: 67,631,803	W261R	probably damaging	Het
Mroh3	T	A	1: 136,181,795	R891S	probably benign	Het
Mtcl1	T	A	17: 66,343,611	M1620L	probably benign	Het
Myo18a	T	C	11: 77,778,073	V253A	possibly damaging	Het
Olfr1453	A	T	19: 13,027,913	C139S	probably damaging	Het
Pcdhb22	A	T	18: 37,519,669	N140Y	probably damaging	Het
Ppp1r9b	T	C	11: 94,992,428	V294A	probably benign	Het
Ptk7	A	T	17: 46,566,191	D980E	probably damaging	Het
Rdh11	T	A	12: 79,191,939		probably benign	Het
Sec23ip	T	G	7: 128,764,081	L558R	probably damaging	Het
Slc22a26	C	T	19: 7,785,194	M460I	probably benign	Het
Smc1b	G	A	15: 85,120,674	Q400*	probably null	Het
Spg11	T	C	2: 122,088,307	E947G	probably damaging	Het
Stab1	T	C	14: 31,154,848	I840V	probably benign	Het
Tlk1	T	C	2: 70,786,933	T68A	possibly damaging	Het
Traip	A	G	9: 107,963,350	I273V	probably benign	Het
Trim30c	T	G	7: 104,382,065	*514C	probably null	Het
U2surp	A	G	9: 95,481,663	Y615H	probably damaging	Het

Other mutations in Man2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Man2b1	APN	8	85084638	splice site	probably null
IGL00671:Man2b1	APN	8	85093938	missense	probably damaging	0.98
IGL01538:Man2b1	APN	8	85097430	missense	probably benign	0.00
dateline	UTSW	8	85084737	missense	probably damaging	1.00
greenwich	UTSW	8	85085456	nonsense	probably null
longitude	UTSW	8	85095144	nonsense	probably null
meridian	UTSW	8	85096752	missense	probably damaging	1.00
R0018:Man2b1	UTSW	8	85097489	missense	probably damaging	1.00
R0302:Man2b1	UTSW	8	85093016	missense	probably damaging	1.00
R0574:Man2b1	UTSW	8	85096776	missense	probably benign
R0727:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
R0837:Man2b1	UTSW	8	85096829	missense	possibly damaging	0.92
R1087:Man2b1	UTSW	8	85095171	missense	probably damaging	1.00
R1471:Man2b1	UTSW	8	85086845	missense	probably damaging	0.99
R1745:Man2b1	UTSW	8	85093934	missense	probably damaging	1.00
R1903:Man2b1	UTSW	8	85086822	missense	probably damaging	1.00
R2026:Man2b1	UTSW	8	85095335	missense	probably damaging	0.99
R2071:Man2b1	UTSW	8	85085384	missense	possibly damaging	0.90
R2120:Man2b1	UTSW	8	85093024	splice site	probably benign
R3897:Man2b1	UTSW	8	85096948	splice site	probably benign
R3971:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R3972:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R4096:Man2b1	UTSW	8	85084737	missense	probably damaging	1.00
R4497:Man2b1	UTSW	8	85090936	missense	probably benign	0.22
R5183:Man2b1	UTSW	8	85095784	missense	probably damaging	1.00
R5191:Man2b1	UTSW	8	85084459	missense	probably damaging	1.00
R5644:Man2b1	UTSW	8	85094210	missense	possibly damaging	0.61
R6027:Man2b1	UTSW	8	85096752	missense	probably damaging	1.00
R6291:Man2b1	UTSW	8	85097046	missense	probably benign	0.44
R6341:Man2b1	UTSW	8	85095399	missense	probably damaging	1.00
R6467:Man2b1	UTSW	8	85097447	missense	possibly damaging	0.91
R6622:Man2b1	UTSW	8	85084479	missense	probably damaging	1.00
R6624:Man2b1	UTSW	8	85096853	missense	probably benign	0.01
R6631:Man2b1	UTSW	8	85086811	splice site	probably null
R6828:Man2b1	UTSW	8	85086919	missense	possibly damaging	0.88
R6983:Man2b1	UTSW	8	85091071	splice site	probably null
R7159:Man2b1	UTSW	8	85087280	missense	probably benign	0.09
R7267:Man2b1	UTSW	8	85087175	missense	probably damaging	1.00
R7537:Man2b1	UTSW	8	85090965	nonsense	probably null
R7786:Man2b1	UTSW	8	85085456	nonsense	probably null
R8022:Man2b1	UTSW	8	85095613	missense	probably damaging	1.00
R8069:Man2b1	UTSW	8	85097045	missense	probably benign	0.03
R8251:Man2b1	UTSW	8	85095129	missense	probably damaging	0.99
R8406:Man2b1	UTSW	8	85096278	missense	probably damaging	1.00
R8464:Man2b1	UTSW	8	85094143	missense	possibly damaging	0.55
R8701:Man2b1	UTSW	8	85095153	missense	probably damaging	1.00
R8792:Man2b1	UTSW	8	85095144	nonsense	probably null
R8891:Man2b1	UTSW	8	85084455	missense	probably damaging	1.00
R8930:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8932:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8953:Man2b1	UTSW	8	85091910	missense	probably benign	0.36
Z1176:Man2b1	UTSW	8	85093938	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCACCTCTTCGTAAGTGTCATCTG -3'
(R):5'- TCTGCACTAAGGTCTGCACC -3'

Sequencing Primer
(F):5'- CATCTGTTGACCATGGATTGAATG -3'
(R):5'- ACTAAGGTCTGCACCCCAGG -3'

Posted On

2021-11-19