Incidental Mutation 'R9059:Dsg4'
ID 688893
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R9059 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20471125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 883 (M883K)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000019426
AA Change: M883K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: M883K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik A T 12: 24,074,731 D48E probably benign Het
Ablim2 A G 5: 35,802,506 T101A probably damaging Het
Acot8 A G 2: 164,792,909 S316P probably benign Het
Acta2 G T 19: 34,241,755 A349D possibly damaging Het
Adgrv1 C A 13: 81,414,573 probably null Het
Ankrd55 A G 13: 112,318,539 D57G probably damaging Het
Azin2 A G 4: 128,934,647 Y351H probably benign Het
Ccdc142 T C 6: 83,102,419 C246R probably damaging Het
Col25a1 C A 3: 130,474,850 Q179K unknown Het
Ddx46 C T 13: 55,652,108 A277V probably benign Het
Diaph1 T A 18: 37,889,745 N792I possibly damaging Het
Dnah11 G A 12: 118,130,843 P830L probably benign Het
Dnah3 C G 7: 120,085,145 R252S probably benign Het
Dnah5 A G 15: 28,245,666 D550G probably benign Het
Dph3 T C 14: 32,085,427 N31D probably benign Het
Dsg1c A T 18: 20,275,249 T452S probably damaging Het
Epn1 T G 7: 5,095,068 S293A probably benign Het
Fggy T A 4: 95,800,604 Y318* probably null Het
Gm11639 T C 11: 104,751,863 V1104A possibly damaging Het
Hip1 A G 5: 135,428,743 L703P probably benign Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igf2r GCAGCCCTCCATAGGCGCCAGCCCTCCATAGGCGC GCAGCCCTCCATAGGCGC 17: 12,751,293 probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Larp4 A G 15: 99,991,812 E204G probably benign Het
Lbr A G 1: 181,817,554 I511T Het
Lingo3 G T 10: 80,834,689 T469K probably benign Het
Lrrc30 A T 17: 67,631,803 W261R probably damaging Het
Man2b1 T C 8: 85,091,526 V442A probably damaging Het
Mroh3 T A 1: 136,181,795 R891S probably benign Het
Mtcl1 T A 17: 66,343,611 M1620L probably benign Het
Myo18a T C 11: 77,778,073 V253A possibly damaging Het
Olfr1453 A T 19: 13,027,913 C139S probably damaging Het
Pcdhb22 A T 18: 37,519,669 N140Y probably damaging Het
Ppp1r9b T C 11: 94,992,428 V294A probably benign Het
Ptk7 A T 17: 46,566,191 D980E probably damaging Het
Rdh11 T A 12: 79,191,939 probably benign Het
Sec23ip T G 7: 128,764,081 L558R probably damaging Het
Slc22a26 C T 19: 7,785,194 M460I probably benign Het
Smc1b G A 15: 85,120,674 Q400* probably null Het
Spg11 T C 2: 122,088,307 E947G probably damaging Het
Stab1 T C 14: 31,154,848 I840V probably benign Het
Tlk1 T C 2: 70,786,933 T68A possibly damaging Het
Traip A G 9: 107,963,350 I273V probably benign Het
Trim30c T G 7: 104,382,065 *514C probably null Het
U2surp A G 9: 95,481,663 Y615H probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20452990 missense probably benign 0.00
R9765:Dsg4 UTSW 18 20471277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTATGATCACGAAGGAGCTGGG -3'
(R):5'- GCCATTACGGTTTCGGTCAC -3'

Sequencing Primer
(F):5'- TCCATTGGCTGCTGCAG -3'
(R):5'- CGACTACGTTTGGTGGAATCTGAG -3'
Posted On 2021-11-19