Mutagenetix > Incidental Mutation

Incidental Mutation 'R9061:Pask'

688954

Institutional Source

Beutler Lab

Gene Symbol

Pask

Ensembl Gene

ENSMUSG00000026274

Gene Name

PAS domain containing serine/threonine kinase

Synonyms

Paskin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R9061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93308770-93343482 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 93325469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 399 (Q399*)

Ref Sequence

ENSEMBL: ENSMUSP00000027493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027493]

AlphaFold

Q8CEE6

Predicted Effect

probably null
Transcript: ENSMUST00000027493
AA Change: Q399*

SMART Domains

Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: Q399*

Domain	Start	End	E-Value	Type
PAS	119	186	3.87e-8	SMART
PAS	333	400	3.08e-2	SMART
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1043	1054	N/A	INTRINSIC
S_TKc	1059	1311	8.16e-79	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930518I15Rik	A	G	2: 156,857,213	M1T	probably null	Het
Abca13	A	G	11: 9,277,847	E630G	probably benign	Het
Abcf2	T	A	5: 24,573,506	H218L	possibly damaging	Het
Abo	A	T	2: 26,843,383	M268K	probably benign	Het
Ankrd33	G	T	15: 101,116,148		probably benign	Het
Apc	G	C	18: 34,313,198	R1049T	probably damaging	Het
Atg16l2	T	C	7: 101,292,131	K412E	probably damaging	Het
Cachd1	G	A	4: 100,952,005		probably null	Het
Ccdc152	T	G	15: 3,301,161	K11Q	probably damaging	Het
Ccdc38	T	A	10: 93,565,873	W232R	probably damaging	Het
Cluh	C	T	11: 74,660,366	P347L	possibly damaging	Het
Cntn3	A	G	6: 102,337,327	L142P	probably damaging	Het
Ctnnd2	T	A	15: 30,806,738	M601K	probably damaging	Het
D930048N14Rik	G	A	11: 51,654,907	D209N	unknown	Het
Dcaf6	A	T	1: 165,336,763	N814K	probably damaging	Het
Dhx8	A	T	11: 101,741,580	D455V	possibly damaging	Het
Fam71f1	C	T	6: 29,323,903	T209I	probably benign	Het
Fcna	A	C	2: 25,624,944	L301W	possibly damaging	Het
Gdf9	T	G	11: 53,433,442	C13G	probably damaging	Het
Gm13083	T	G	4: 143,616,171	S283A	possibly damaging	Het
Gm4763	A	T	7: 24,722,748	I192N	possibly damaging	Het
Hells	T	A	19: 38,945,414	N226K	probably damaging	Het
Hes6	A	G	1: 91,412,339	S132P	probably damaging	Het
Ifi207	A	T	1: 173,736,587		probably benign	Het
Ighv16-1	A	T	12: 114,068,884	Y99*	probably null	Het
Kirrel2	T	C	7: 30,450,880	I508V	probably benign	Het
Klhl38	T	A	15: 58,322,626	I236F	probably damaging	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Lamc1	A	T	1: 153,251,124	C425*	probably null	Het
Letm1	A	G	5: 33,760,869	F311L	probably damaging	Het
Mapk8ip2	T	C	15: 89,457,813	V409A	possibly damaging	Het
Mybpc1	C	T	10: 88,555,639	C318Y	probably damaging	Het
Myo15	A	G	11: 60,502,866	Y1141C		Het
Ndufv2	T	A	17: 66,083,480	D165V	probably damaging	Het
Nrde2	T	C	12: 100,143,864	K303E	probably benign	Het
Nup205	T	A	6: 35,219,873		probably benign	Het
Olfr1474	A	G	19: 13,471,159	N21S	probably damaging	Het
Olfr340	A	G	2: 36,452,885	Q100R	probably damaging	Het
Olfr452	A	T	6: 42,790,207	H56L	probably damaging	Het
Otof	C	T	5: 30,388,657	V451I	possibly damaging	Het
Pbk	T	A	14: 65,811,990	F39I	probably benign	Het
Pdzd2	T	C	15: 12,374,667	K1794R	possibly damaging	Het
Pibf1	T	C	14: 99,186,633		probably null	Het
Ppip5k2	G	A	1: 97,717,462	T1089I	probably damaging	Het
Ppp1cb	T	A	5: 32,478,148	F45L	possibly damaging	Het
Samd4	T	C	14: 47,064,271	F344S	probably damaging	Het
Slc2a13	C	T	15: 91,350,130	M334I	possibly damaging	Het
Slc37a1	C	T	17: 31,337,391	A363V	probably damaging	Het
Slc8a3	T	A	12: 81,216,766	I616F	probably damaging	Het
Srcin1	A	G	11: 97,536,380	L257P	probably damaging	Het
Tarbp1	A	G	8: 126,447,141	F945L	probably damaging	Het
Thbs4	A	T	13: 92,774,679		probably null	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Trim62	G	A	4: 128,909,170	V338M	probably damaging	Het
Ttll9	C	T	2: 152,976,193	H20Y	possibly damaging	Het
Uevld	A	T	7: 46,938,058	I298N	probably damaging	Het
Zan	T	C	5: 137,464,391	E842G	probably damaging	Het
Zdbf2	T	G	1: 63,307,137	S1558R		Het

Other mutations in Pask

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01366:Pask	APN	1	93310852	missense	probably benign	0.02
IGL01620:Pask	APN	1	93310122	missense	possibly damaging	0.87
IGL01959:Pask	APN	1	93334607	missense	probably benign	0.03
IGL02170:Pask	APN	1	93310884	missense	possibly damaging	0.69
IGL02499:Pask	APN	1	93321095	nonsense	probably null
IGL02670:Pask	APN	1	93310818	missense	probably damaging	1.00
IGL03066:Pask	APN	1	93330866	missense	probably benign	0.02
IGL03210:Pask	APN	1	93319992	missense	possibly damaging	0.92
R0472:Pask	UTSW	1	93320917	missense	probably benign	0.00
R0524:Pask	UTSW	1	93310834	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327400	missense	probably damaging	0.99
R0854:Pask	UTSW	1	93327412	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327434	missense	possibly damaging	0.79
R0863:Pask	UTSW	1	93314339	missense	probably damaging	1.00
R1052:Pask	UTSW	1	93330827	missense	probably benign	0.00
R1406:Pask	UTSW	1	93321651	missense	probably benign	0.00
R1406:Pask	UTSW	1	93321651	missense	probably benign	0.00
R1831:Pask	UTSW	1	93320769	splice site	probably null
R1958:Pask	UTSW	1	93321458	missense	probably benign	0.00
R2143:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2144:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2145:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2509:Pask	UTSW	1	93330763	missense	possibly damaging	0.62
R2858:Pask	UTSW	1	93321651	missense	probably benign	0.00
R2899:Pask	UTSW	1	93334547	missense	probably damaging	1.00
R3545:Pask	UTSW	1	93317115	missense	probably damaging	1.00
R3778:Pask	UTSW	1	93327467	missense	probably damaging	1.00
R4111:Pask	UTSW	1	93310818	missense	probably damaging	1.00
R4514:Pask	UTSW	1	93322133	missense	probably benign	0.03
R4527:Pask	UTSW	1	93320502	missense	probably benign
R4580:Pask	UTSW	1	93322108	missense	probably benign	0.36
R4718:Pask	UTSW	1	93322196	missense	possibly damaging	0.67
R4775:Pask	UTSW	1	93337524	missense	probably damaging	0.97
R5036:Pask	UTSW	1	93322079	nonsense	probably null
R5070:Pask	UTSW	1	93330874	missense	probably damaging	1.00
R5084:Pask	UTSW	1	93322097	missense	probably benign
R5151:Pask	UTSW	1	93334628	missense	probably damaging	1.00
R5196:Pask	UTSW	1	93310083	unclassified	probably benign
R5643:Pask	UTSW	1	93337343	critical splice donor site	probably null
R5739:Pask	UTSW	1	93322056	missense	probably benign
R6126:Pask	UTSW	1	93314359	missense	probably damaging	1.00
R7161:Pask	UTSW	1	93310905	missense	probably benign
R7284:Pask	UTSW	1	93320669	missense	probably benign	0.01
R7289:Pask	UTSW	1	93331587	missense	probably damaging	1.00
R8277:Pask	UTSW	1	93325363	critical splice donor site	probably null
R8303:Pask	UTSW	1	93320564	missense	probably benign	0.10
R8309:Pask	UTSW	1	93312851	nonsense	probably null
R8321:Pask	UTSW	1	93320655	missense	possibly damaging	0.85
R8476:Pask	UTSW	1	93321639	missense	probably benign	0.00
R8814:Pask	UTSW	1	93320585	missense	probably benign	0.00
R9198:Pask	UTSW	1	93337483	missense	possibly damaging	0.72
R9406:Pask	UTSW	1	93324265	missense	probably benign	0.02
R9578:Pask	UTSW	1	93335668	missense	probably benign	0.00
Z1088:Pask	UTSW	1	93316801	missense	probably damaging	1.00
Z1177:Pask	UTSW	1	93335732	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACAGAGCCTCTCATTGC -3'
(R):5'- TGAACTGTTCATTCACATTGCTGC -3'

Sequencing Primer
(F):5'- AAAGGTCACTAGGGGCCTCTG -3'
(R):5'- GCTATTCTCATTTTCCAAGGAGG -3'

Posted On

2021-11-19