Incidental Mutation 'R9061:Lamc1'
ID 688956
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9061 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 153218922-153332786 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 153251124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 425 (C425*)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027752
AA Change: C425*
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: C425*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik A G 2: 156,857,213 M1T probably null Het
Abca13 A G 11: 9,277,847 E630G probably benign Het
Abcf2 T A 5: 24,573,506 H218L possibly damaging Het
Abo A T 2: 26,843,383 M268K probably benign Het
Ankrd33 G T 15: 101,116,148 probably benign Het
Apc G C 18: 34,313,198 R1049T probably damaging Het
Atg16l2 T C 7: 101,292,131 K412E probably damaging Het
Cachd1 G A 4: 100,952,005 probably null Het
Ccdc152 T G 15: 3,301,161 K11Q probably damaging Het
Ccdc38 T A 10: 93,565,873 W232R probably damaging Het
Cluh C T 11: 74,660,366 P347L possibly damaging Het
Cntn3 A G 6: 102,337,327 L142P probably damaging Het
Ctnnd2 T A 15: 30,806,738 M601K probably damaging Het
D930048N14Rik G A 11: 51,654,907 D209N unknown Het
Dcaf6 A T 1: 165,336,763 N814K probably damaging Het
Dhx8 A T 11: 101,741,580 D455V possibly damaging Het
Fam71f1 C T 6: 29,323,903 T209I probably benign Het
Fcna A C 2: 25,624,944 L301W possibly damaging Het
Gdf9 T G 11: 53,433,442 C13G probably damaging Het
Gm13083 T G 4: 143,616,171 S283A possibly damaging Het
Gm4763 A T 7: 24,722,748 I192N possibly damaging Het
Hells T A 19: 38,945,414 N226K probably damaging Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ifi207 A T 1: 173,736,587 probably benign Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kirrel2 T C 7: 30,450,880 I508V probably benign Het
Klhl38 T A 15: 58,322,626 I236F probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Letm1 A G 5: 33,760,869 F311L probably damaging Het
Mapk8ip2 T C 15: 89,457,813 V409A possibly damaging Het
Mybpc1 C T 10: 88,555,639 C318Y probably damaging Het
Myo15 A G 11: 60,502,866 Y1141C Het
Ndufv2 T A 17: 66,083,480 D165V probably damaging Het
Nrde2 T C 12: 100,143,864 K303E probably benign Het
Nup205 T A 6: 35,219,873 probably benign Het
Olfr1474 A G 19: 13,471,159 N21S probably damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr452 A T 6: 42,790,207 H56L probably damaging Het
Otof C T 5: 30,388,657 V451I possibly damaging Het
Pask G A 1: 93,325,469 Q399* probably null Het
Pbk T A 14: 65,811,990 F39I probably benign Het
Pdzd2 T C 15: 12,374,667 K1794R possibly damaging Het
Pibf1 T C 14: 99,186,633 probably null Het
Ppip5k2 G A 1: 97,717,462 T1089I probably damaging Het
Ppp1cb T A 5: 32,478,148 F45L possibly damaging Het
Samd4 T C 14: 47,064,271 F344S probably damaging Het
Slc2a13 C T 15: 91,350,130 M334I possibly damaging Het
Slc37a1 C T 17: 31,337,391 A363V probably damaging Het
Slc8a3 T A 12: 81,216,766 I616F probably damaging Het
Srcin1 A G 11: 97,536,380 L257P probably damaging Het
Tarbp1 A G 8: 126,447,141 F945L probably damaging Het
Thbs4 A T 13: 92,774,679 probably null Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim62 G A 4: 128,909,170 V338M probably damaging Het
Ttll9 C T 2: 152,976,193 H20Y possibly damaging Het
Uevld A T 7: 46,938,058 I298N probably damaging Het
Zan T C 5: 137,464,391 E842G probably damaging Het
Zdbf2 T G 1: 63,307,137 S1558R Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153240495 missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153251134 missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153221573 missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153247082 missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153240433 missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153247042 missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153249853 missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153250661 missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153247055 missense probably benign 0.00
IGL03069:Lamc1 APN 1 153239381 missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153332274 missense probably benign 0.00
IGL03166:Lamc1 APN 1 153332301 missense probably benign 0.01
IGL03285:Lamc1 APN 1 153227685 missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153262646 missense probably damaging 1.00
pride UTSW 1 153247284 missense probably benign 0.01
Stratum UTSW 1 153251124 nonsense probably null
tier UTSW 1 153250522 missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153243471 missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153262583 missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153241868 unclassified probably benign
R0078:Lamc1 UTSW 1 153229190 missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153262607 missense probably benign 0.00
R0282:Lamc1 UTSW 1 153255312 missense probably benign
R0374:Lamc1 UTSW 1 153251065 splice site probably benign
R0494:Lamc1 UTSW 1 153246936 critical splice donor site probably null
R0502:Lamc1 UTSW 1 153246932 splice site probably benign
R0755:Lamc1 UTSW 1 153247450 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0792:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0892:Lamc1 UTSW 1 153332254 missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153332274 missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153221646 frame shift probably null
R0961:Lamc1 UTSW 1 153221700 missense probably benign 0.03
R0963:Lamc1 UTSW 1 153243386 missense probably benign
R1127:Lamc1 UTSW 1 153250459 missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153247231 splice site probably benign
R1175:Lamc1 UTSW 1 153247231 splice site probably benign
R1449:Lamc1 UTSW 1 153250495 missense probably benign
R1481:Lamc1 UTSW 1 153221634 missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153242743 missense probably benign 0.34
R1583:Lamc1 UTSW 1 153243478 critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153258072 splice site probably benign
R1652:Lamc1 UTSW 1 153249646 missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153247249 missense probably benign 0.04
R1854:Lamc1 UTSW 1 153249872 missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153242632 missense probably benign 0.07
R2170:Lamc1 UTSW 1 153249142 missense probably benign 0.07
R2410:Lamc1 UTSW 1 153247395 missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153226415 missense probably benign 0.04
R3615:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153255205 missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153262708 splice site probably null
R4285:Lamc1 UTSW 1 153234552 missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153221528 missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153247269 missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153242696 missense probably benign 0.04
R4649:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153229100 missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153233564 missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153251970 missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153247284 missense probably benign 0.01
R6233:Lamc1 UTSW 1 153223666 missense probably benign
R6431:Lamc1 UTSW 1 153221671 missense probably benign 0.21
R6636:Lamc1 UTSW 1 153241975 missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153262492 missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153226454 missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153234650 missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153249076 missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153332265 missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153243275 missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153243232 missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153240454 missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153249060 missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153247268 missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153221612 missense probably benign 0.04
R8207:Lamc1 UTSW 1 153250522 missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153247327 missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153223754 missense probably benign 0.04
R8315:Lamc1 UTSW 1 153243421 missense probably benign 0.00
R8417:Lamc1 UTSW 1 153230769 missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153233542 missense probably benign 0.31
R8827:Lamc1 UTSW 1 153221678 missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153332247 missense probably benign 0.00
R9141:Lamc1 UTSW 1 153247450 missense probably benign 0.01
R9187:Lamc1 UTSW 1 153221688 nonsense probably null
R9206:Lamc1 UTSW 1 153250451 missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153243341 missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153239263 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCGTGATGAAACCTAATACTG -3'
(R):5'- TCAGGCATTGCTTTTGGCTC -3'

Sequencing Primer
(F):5'- GAAACCTAATACTGTACATGCTAGC -3'
(R):5'- ATTGCTTTTGGCTCCTGCTTG -3'
Posted On 2021-11-19