Incidental Mutation 'R9061:Letm1'
ID 688969
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Name leucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R9061 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33739673-33782817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33760869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 311 (F311L)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
AlphaFold Q9Z2I0
Predicted Effect probably damaging
Transcript: ENSMUST00000005431
AA Change: F311L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: F311L

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik A G 2: 156,857,213 M1T probably null Het
Abca13 A G 11: 9,277,847 E630G probably benign Het
Abcf2 T A 5: 24,573,506 H218L possibly damaging Het
Abo A T 2: 26,843,383 M268K probably benign Het
Ankrd33 G T 15: 101,116,148 probably benign Het
Apc G C 18: 34,313,198 R1049T probably damaging Het
Atg16l2 T C 7: 101,292,131 K412E probably damaging Het
Cachd1 G A 4: 100,952,005 probably null Het
Ccdc152 T G 15: 3,301,161 K11Q probably damaging Het
Ccdc38 T A 10: 93,565,873 W232R probably damaging Het
Cluh C T 11: 74,660,366 P347L possibly damaging Het
Cntn3 A G 6: 102,337,327 L142P probably damaging Het
Ctnnd2 T A 15: 30,806,738 M601K probably damaging Het
D930048N14Rik G A 11: 51,654,907 D209N unknown Het
Dcaf6 A T 1: 165,336,763 N814K probably damaging Het
Dhx8 A T 11: 101,741,580 D455V possibly damaging Het
Fam71f1 C T 6: 29,323,903 T209I probably benign Het
Fcna A C 2: 25,624,944 L301W possibly damaging Het
Gdf9 T G 11: 53,433,442 C13G probably damaging Het
Gm13083 T G 4: 143,616,171 S283A possibly damaging Het
Gm4763 A T 7: 24,722,748 I192N possibly damaging Het
Hells T A 19: 38,945,414 N226K probably damaging Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ifi207 A T 1: 173,736,587 probably benign Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kirrel2 T C 7: 30,450,880 I508V probably benign Het
Klhl38 T A 15: 58,322,626 I236F probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lamc1 A T 1: 153,251,124 C425* probably null Het
Mapk8ip2 T C 15: 89,457,813 V409A possibly damaging Het
Mybpc1 C T 10: 88,555,639 C318Y probably damaging Het
Myo15 A G 11: 60,502,866 Y1141C Het
Ndufv2 T A 17: 66,083,480 D165V probably damaging Het
Nrde2 T C 12: 100,143,864 K303E probably benign Het
Nup205 T A 6: 35,219,873 probably benign Het
Olfr1474 A G 19: 13,471,159 N21S probably damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr452 A T 6: 42,790,207 H56L probably damaging Het
Otof C T 5: 30,388,657 V451I possibly damaging Het
Pask G A 1: 93,325,469 Q399* probably null Het
Pbk T A 14: 65,811,990 F39I probably benign Het
Pdzd2 T C 15: 12,374,667 K1794R possibly damaging Het
Pibf1 T C 14: 99,186,633 probably null Het
Ppip5k2 G A 1: 97,717,462 T1089I probably damaging Het
Ppp1cb T A 5: 32,478,148 F45L possibly damaging Het
Samd4 T C 14: 47,064,271 F344S probably damaging Het
Slc2a13 C T 15: 91,350,130 M334I possibly damaging Het
Slc37a1 C T 17: 31,337,391 A363V probably damaging Het
Slc8a3 T A 12: 81,216,766 I616F probably damaging Het
Srcin1 A G 11: 97,536,380 L257P probably damaging Het
Tarbp1 A G 8: 126,447,141 F945L probably damaging Het
Thbs4 A T 13: 92,774,679 probably null Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim62 G A 4: 128,909,170 V338M probably damaging Het
Ttll9 C T 2: 152,976,193 H20Y possibly damaging Het
Uevld A T 7: 46,938,058 I298N probably damaging Het
Zan T C 5: 137,464,391 E842G probably damaging Het
Zdbf2 T G 1: 63,307,137 S1558R Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33762505 missense probably damaging 1.00
R9028:Letm1 UTSW 5 33752503 missense probably damaging 1.00
R9420:Letm1 UTSW 5 33769458 missense probably damaging 1.00
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAATAGGGGAGGCTTCTG -3'
(R):5'- GTATAATGGTGCAGCCCAGG -3'

Sequencing Primer
(F):5'- GGCCCACCTCACCTTATCATCAG -3'
(R):5'- TGAGGCTGACAGCTCCTG -3'
Posted On 2021-11-19