Incidental Mutation 'R9061:Mybpc1'
ID 688980
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 068887-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.837) question?
Stock # R9061 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88391501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 318 (C318Y)
Ref Sequence ENSEMBL: ENSMUSP00000112699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably damaging
Transcript: ENSMUST00000119185
AA Change: C318Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: C318Y

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121629
AA Change: C332Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: C332Y

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik A G 2: 156,699,133 (GRCm39) M1T probably null Het
Abca13 A G 11: 9,227,847 (GRCm39) E630G probably benign Het
Abcf2 T A 5: 24,778,504 (GRCm39) H218L possibly damaging Het
Abo A T 2: 26,733,395 (GRCm39) M268K probably benign Het
Ankrd33 G T 15: 101,014,029 (GRCm39) probably benign Het
Apc G C 18: 34,446,251 (GRCm39) R1049T probably damaging Het
Atg16l2 T C 7: 100,941,338 (GRCm39) K412E probably damaging Het
Cachd1 G A 4: 100,809,202 (GRCm39) probably null Het
Ccdc152 T G 15: 3,330,643 (GRCm39) K11Q probably damaging Het
Ccdc38 T A 10: 93,401,735 (GRCm39) W232R probably damaging Het
Cluh C T 11: 74,551,192 (GRCm39) P347L possibly damaging Het
Cntn3 A G 6: 102,314,288 (GRCm39) L142P probably damaging Het
Ctnnd2 T A 15: 30,806,884 (GRCm39) M601K probably damaging Het
D930048N14Rik G A 11: 51,545,734 (GRCm39) D209N unknown Het
Dcaf6 A T 1: 165,164,332 (GRCm39) N814K probably damaging Het
Dhx8 A T 11: 101,632,406 (GRCm39) D455V possibly damaging Het
Fcna A C 2: 25,514,956 (GRCm39) L301W possibly damaging Het
Garin1b C T 6: 29,323,902 (GRCm39) T209I probably benign Het
Gdf9 T G 11: 53,324,269 (GRCm39) C13G probably damaging Het
Hells T A 19: 38,933,858 (GRCm39) N226K probably damaging Het
Hes6 A G 1: 91,340,061 (GRCm39) S132P probably damaging Het
Ifi207 A T 1: 173,564,153 (GRCm39) probably benign Het
Ighv16-1 A T 12: 114,032,504 (GRCm39) Y99* probably null Het
Kirrel2 T C 7: 30,150,305 (GRCm39) I508V probably benign Het
Klhl38 T A 15: 58,186,022 (GRCm39) I236F probably damaging Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Lamc1 A T 1: 153,126,870 (GRCm39) C425* probably null Het
Letm1 A G 5: 33,918,213 (GRCm39) F311L probably damaging Het
Lypd11 A T 7: 24,422,173 (GRCm39) I192N possibly damaging Het
Mapk8ip2 T C 15: 89,342,016 (GRCm39) V409A possibly damaging Het
Myo15a A G 11: 60,393,692 (GRCm39) Y1141C Het
Ndufv2 T A 17: 66,390,475 (GRCm39) D165V probably damaging Het
Nrde2 T C 12: 100,110,123 (GRCm39) K303E probably benign Het
Nup205 T A 6: 35,196,808 (GRCm39) probably benign Het
Or1j12 A G 2: 36,342,897 (GRCm39) Q100R probably damaging Het
Or2f2 A T 6: 42,767,141 (GRCm39) H56L probably damaging Het
Or5b118 A G 19: 13,448,523 (GRCm39) N21S probably damaging Het
Otof C T 5: 30,546,001 (GRCm39) V451I possibly damaging Het
Pask G A 1: 93,253,191 (GRCm39) Q399* probably null Het
Pbk T A 14: 66,049,439 (GRCm39) F39I probably benign Het
Pdzd2 T C 15: 12,374,753 (GRCm39) K1794R possibly damaging Het
Pibf1 T C 14: 99,424,069 (GRCm39) probably null Het
Ppip5k2 G A 1: 97,645,187 (GRCm39) T1089I probably damaging Het
Ppp1cb T A 5: 32,635,492 (GRCm39) F45L possibly damaging Het
Pramel21 T G 4: 143,342,741 (GRCm39) S283A possibly damaging Het
Samd4 T C 14: 47,301,728 (GRCm39) F344S probably damaging Het
Slc2a13 C T 15: 91,234,333 (GRCm39) M334I possibly damaging Het
Slc37a1 C T 17: 31,556,365 (GRCm39) A363V probably damaging Het
Slc8a3 T A 12: 81,263,540 (GRCm39) I616F probably damaging Het
Srcin1 A G 11: 97,427,206 (GRCm39) L257P probably damaging Het
Tarbp1 A G 8: 127,173,880 (GRCm39) F945L probably damaging Het
Thbs4 A T 13: 92,911,187 (GRCm39) probably null Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Trim62 G A 4: 128,802,963 (GRCm39) V338M probably damaging Het
Ttll9 C T 2: 152,818,113 (GRCm39) H20Y possibly damaging Het
Uevld A T 7: 46,587,806 (GRCm39) I298N probably damaging Het
Zan T C 5: 137,462,653 (GRCm39) E842G probably damaging Het
Zdbf2 T G 1: 63,346,296 (GRCm39) S1558R Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2200:Mybpc1 UTSW 10 88,391,557 (GRCm39) missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTAATGGACCTGCAATACTGAGC -3'
(R):5'- ATCACAGCTTTATCCTTGATGCTTG -3'

Sequencing Primer
(F):5'- TGGACCTGCAATACTGAGCCAATC -3'
(R):5'- CATCTCAAACTATGCCTTCT -3'
Posted On 2021-11-19