Incidental Mutation 'R9061:Cluh'
ID 688986
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Name clustered mitochondria (cluA/CLU1) homolog
Synonyms 1300001I01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R9061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74649495-74670847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74660366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 347 (P347L)
Ref Sequence ENSEMBL: ENSMUSP00000090593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000092915
AA Change: P347L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: P347L

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117818
AA Change: P347L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: P347L

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik A G 2: 156,857,213 M1T probably null Het
Abca13 A G 11: 9,277,847 E630G probably benign Het
Abcf2 T A 5: 24,573,506 H218L possibly damaging Het
Abo A T 2: 26,843,383 M268K probably benign Het
Ankrd33 G T 15: 101,116,148 probably benign Het
Apc G C 18: 34,313,198 R1049T probably damaging Het
Atg16l2 T C 7: 101,292,131 K412E probably damaging Het
Cachd1 G A 4: 100,952,005 probably null Het
Ccdc152 T G 15: 3,301,161 K11Q probably damaging Het
Ccdc38 T A 10: 93,565,873 W232R probably damaging Het
Cntn3 A G 6: 102,337,327 L142P probably damaging Het
Ctnnd2 T A 15: 30,806,738 M601K probably damaging Het
D930048N14Rik G A 11: 51,654,907 D209N unknown Het
Dcaf6 A T 1: 165,336,763 N814K probably damaging Het
Dhx8 A T 11: 101,741,580 D455V possibly damaging Het
Fam71f1 C T 6: 29,323,903 T209I probably benign Het
Fcna A C 2: 25,624,944 L301W possibly damaging Het
Gdf9 T G 11: 53,433,442 C13G probably damaging Het
Gm13083 T G 4: 143,616,171 S283A possibly damaging Het
Gm4763 A T 7: 24,722,748 I192N possibly damaging Het
Hells T A 19: 38,945,414 N226K probably damaging Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kirrel2 T C 7: 30,450,880 I508V probably benign Het
Klhl38 T A 15: 58,322,626 I236F probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lamc1 A T 1: 153,251,124 C425* probably null Het
Letm1 A G 5: 33,760,869 F311L probably damaging Het
Mapk8ip2 T C 15: 89,457,813 V409A possibly damaging Het
Mybpc1 C T 10: 88,555,639 C318Y probably damaging Het
Myo15 A G 11: 60,502,866 Y1141C Het
Ndufv2 T A 17: 66,083,480 D165V probably damaging Het
Nrde2 T C 12: 100,143,864 K303E probably benign Het
Olfr1474 A G 19: 13,471,159 N21S probably damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr452 A T 6: 42,790,207 H56L probably damaging Het
Otof C T 5: 30,388,657 V451I possibly damaging Het
Pask G A 1: 93,325,469 Q399* probably null Het
Pbk T A 14: 65,811,990 F39I probably benign Het
Pdzd2 T C 15: 12,374,667 K1794R possibly damaging Het
Pibf1 T C 14: 99,186,633 probably null Het
Ppip5k2 G A 1: 97,717,462 T1089I probably damaging Het
Ppp1cb T A 5: 32,478,148 F45L possibly damaging Het
Samd4 T C 14: 47,064,271 F344S probably damaging Het
Slc2a13 C T 15: 91,350,130 M334I possibly damaging Het
Slc37a1 C T 17: 31,337,391 A363V probably damaging Het
Slc8a3 T A 12: 81,216,766 I616F probably damaging Het
Srcin1 A G 11: 97,536,380 L257P probably damaging Het
Tarbp1 A G 8: 126,447,141 F945L probably damaging Het
Thbs4 A T 13: 92,774,679 probably null Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim62 G A 4: 128,909,170 V338M probably damaging Het
Uevld A T 7: 46,938,058 I298N probably damaging Het
Zan T C 5: 137,464,391 E842G probably damaging Het
Zdbf2 T G 1: 63,307,137 S1558R Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
R9326:Cluh UTSW 11 74664076 missense probably benign 0.00
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGCCTGAAGAAATGGTGTC -3'
(R):5'- CATATGAGCCTGGCAGGAAG -3'

Sequencing Primer
(F):5'- AAATGGTGTCCCAGTGCCTGAG -3'
(R):5'- CAGGAAGGGCGGGTCTG -3'
Posted On 2021-11-19