Mutagenetix > Incidental Mutation

Incidental Mutation 'R9061:Cluh'

688986

Institutional Source

Beutler Lab

Gene Symbol

Cluh

Ensembl Gene

ENSMUSG00000020741

Gene Name

clustered mitochondria (cluA/CLU1) homolog

Synonyms

1300001I01Rik

MMRRC Submission

068887-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R9061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74649495-74670847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 74660366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 347 (P347L)

Ref Sequence

ENSEMBL: ENSMUSP00000090593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092915
AA Change: P347L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: P347L

Domain	Start	End	E-Value	Type
Pfam:CLU_N	104	177	3.1e-28	PFAM
Pfam:CLU	394	614	3.4e-89	PFAM
Pfam:eIF3_p135	806	988	1.3e-58	PFAM
Pfam:TPR_10	1059	1100	2.9e-7	PFAM
low complexity region	1114	1125	N/A	INTRINSIC
Pfam:TPR_12	1140	1218	1.7e-10	PFAM
low complexity region	1316	1334	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117818
AA Change: P347L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: P347L

Domain	Start	End	E-Value	Type
Pfam:CLU_N	102	177	9.8e-30	PFAM
Pfam:CLU	394	615	5.3e-92	PFAM
Pfam:eIF3_p135	796	938	2.9e-38	PFAM
Pfam:TPR_10	1008	1049	9.5e-7	PFAM
low complexity region	1063	1074	N/A	INTRINSIC
Pfam:TPR_12	1089	1167	1.1e-9	PFAM
low complexity region	1265	1283	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930518I15Rik	A	G	2: 156,857,213	M1T	probably null	Het
Abca13	A	G	11: 9,277,847	E630G	probably benign	Het
Abcf2	T	A	5: 24,573,506	H218L	possibly damaging	Het
Abo	A	T	2: 26,843,383	M268K	probably benign	Het
Ankrd33	G	T	15: 101,116,148		probably benign	Het
Apc	G	C	18: 34,313,198	R1049T	probably damaging	Het
Atg16l2	T	C	7: 101,292,131	K412E	probably damaging	Het
Cachd1	G	A	4: 100,952,005		probably null	Het
Ccdc152	T	G	15: 3,301,161	K11Q	probably damaging	Het
Ccdc38	T	A	10: 93,565,873	W232R	probably damaging	Het
Cntn3	A	G	6: 102,337,327	L142P	probably damaging	Het
Ctnnd2	T	A	15: 30,806,738	M601K	probably damaging	Het
D930048N14Rik	G	A	11: 51,654,907	D209N	unknown	Het
Dcaf6	A	T	1: 165,336,763	N814K	probably damaging	Het
Dhx8	A	T	11: 101,741,580	D455V	possibly damaging	Het
Fam71f1	C	T	6: 29,323,903	T209I	probably benign	Het
Fcna	A	C	2: 25,624,944	L301W	possibly damaging	Het
Gdf9	T	G	11: 53,433,442	C13G	probably damaging	Het
Gm13083	T	G	4: 143,616,171	S283A	possibly damaging	Het
Gm4763	A	T	7: 24,722,748	I192N	possibly damaging	Het
Hells	T	A	19: 38,945,414	N226K	probably damaging	Het
Hes6	A	G	1: 91,412,339	S132P	probably damaging	Het
Ifi207	A	T	1: 173,736,587		probably benign	Het
Ighv16-1	A	T	12: 114,068,884	Y99*	probably null	Het
Kirrel2	T	C	7: 30,450,880	I508V	probably benign	Het
Klhl38	T	A	15: 58,322,626	I236F	probably damaging	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Lamc1	A	T	1: 153,251,124	C425*	probably null	Het
Letm1	A	G	5: 33,760,869	F311L	probably damaging	Het
Mapk8ip2	T	C	15: 89,457,813	V409A	possibly damaging	Het
Mybpc1	C	T	10: 88,555,639	C318Y	probably damaging	Het
Myo15	A	G	11: 60,502,866	Y1141C		Het
Ndufv2	T	A	17: 66,083,480	D165V	probably damaging	Het
Nrde2	T	C	12: 100,143,864	K303E	probably benign	Het
Nup205	T	A	6: 35,219,873		probably benign	Het
Olfr1474	A	G	19: 13,471,159	N21S	probably damaging	Het
Olfr340	A	G	2: 36,452,885	Q100R	probably damaging	Het
Olfr452	A	T	6: 42,790,207	H56L	probably damaging	Het
Otof	C	T	5: 30,388,657	V451I	possibly damaging	Het
Pask	G	A	1: 93,325,469	Q399*	probably null	Het
Pbk	T	A	14: 65,811,990	F39I	probably benign	Het
Pdzd2	T	C	15: 12,374,667	K1794R	possibly damaging	Het
Pibf1	T	C	14: 99,186,633		probably null	Het
Ppip5k2	G	A	1: 97,717,462	T1089I	probably damaging	Het
Ppp1cb	T	A	5: 32,478,148	F45L	possibly damaging	Het
Samd4	T	C	14: 47,064,271	F344S	probably damaging	Het
Slc2a13	C	T	15: 91,350,130	M334I	possibly damaging	Het
Slc37a1	C	T	17: 31,337,391	A363V	probably damaging	Het
Slc8a3	T	A	12: 81,216,766	I616F	probably damaging	Het
Srcin1	A	G	11: 97,536,380	L257P	probably damaging	Het
Tarbp1	A	G	8: 126,447,141	F945L	probably damaging	Het
Thbs4	A	T	13: 92,774,679		probably null	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Trim62	G	A	4: 128,909,170	V338M	probably damaging	Het
Ttll9	C	T	2: 152,976,193	H20Y	possibly damaging	Het
Uevld	A	T	7: 46,938,058	I298N	probably damaging	Het
Zan	T	C	5: 137,464,391	E842G	probably damaging	Het
Zdbf2	T	G	1: 63,307,137	S1558R		Het

Other mutations in Cluh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cluh	APN	11	74664064	missense	probably benign	0.28
IGL00858:Cluh	APN	11	74659605	missense	possibly damaging	0.86
IGL01380:Cluh	APN	11	74665946	missense	probably benign	0.04
IGL02402:Cluh	APN	11	74657171	missense	probably damaging	1.00
IGL02620:Cluh	APN	11	74665067	nonsense	probably null
IGL02990:Cluh	APN	11	74667765	splice site	probably null
IGL03163:Cluh	APN	11	74666068	missense	probably benign	0.44
IGL03208:Cluh	APN	11	74669506	splice site	probably null
IGL03293:Cluh	APN	11	74665752	missense	probably benign	0.03
IGL03408:Cluh	APN	11	74665953	missense	probably benign	0.06
spent	UTSW	11	74660372	missense	probably damaging	1.00
FR4342:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4342:Cluh	UTSW	11	74669526	small insertion	probably benign
FR4449:Cluh	UTSW	11	74669532	small insertion	probably benign
FR4589:Cluh	UTSW	11	74669531	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669514	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669519	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669524	small insertion	probably benign
FR4737:Cluh	UTSW	11	74669533	small insertion	probably benign
FR4976:Cluh	UTSW	11	74669520	small insertion	probably benign
R0147:Cluh	UTSW	11	74665938	missense	probably damaging	1.00
R0153:Cluh	UTSW	11	74657350	splice site	probably benign
R0506:Cluh	UTSW	11	74664894	missense	probably benign	0.20
R0526:Cluh	UTSW	11	74665986	missense	probably benign	0.05
R0834:Cluh	UTSW	11	74663805	missense	probably benign	0.02
R1873:Cluh	UTSW	11	74662076	missense	possibly damaging	0.72
R1991:Cluh	UTSW	11	74659529	nonsense	probably null
R1992:Cluh	UTSW	11	74660002	missense	probably damaging	1.00
R2095:Cluh	UTSW	11	74661724	nonsense	probably null
R2101:Cluh	UTSW	11	74660502	splice site	probably benign
R2103:Cluh	UTSW	11	74659529	nonsense	probably null
R2220:Cluh	UTSW	11	74667121	missense	probably damaging	1.00
R3702:Cluh	UTSW	11	74665356	missense	probably benign
R3853:Cluh	UTSW	11	74656453	missense	probably benign	0.00
R3900:Cluh	UTSW	11	74667104	missense	probably benign	0.29
R4891:Cluh	UTSW	11	74665059	missense	possibly damaging	0.51
R4895:Cluh	UTSW	11	74667405	missense	probably damaging	1.00
R5056:Cluh	UTSW	11	74661946	missense	probably damaging	1.00
R5089:Cluh	UTSW	11	74660372	missense	probably damaging	1.00
R5217:Cluh	UTSW	11	74659705	missense	probably damaging	1.00
R5346:Cluh	UTSW	11	74665218	missense	probably damaging	1.00
R5382:Cluh	UTSW	11	74665109	intron	probably benign
R5516:Cluh	UTSW	11	74660444	missense	probably damaging	1.00
R5809:Cluh	UTSW	11	74661700	missense	probably damaging	1.00
R6146:Cluh	UTSW	11	74667228	splice site	probably null
R6326:Cluh	UTSW	11	74666242	missense	probably benign	0.10
R6541:Cluh	UTSW	11	74657214	missense	probably damaging	1.00
R6674:Cluh	UTSW	11	74666227	missense	probably damaging	1.00
R6870:Cluh	UTSW	11	74665384	missense	probably damaging	1.00
R6875:Cluh	UTSW	11	74661918	missense	probably damaging	1.00
R7086:Cluh	UTSW	11	74667340	missense	possibly damaging	0.46
R7225:Cluh	UTSW	11	74666406	splice site	probably null
R7310:Cluh	UTSW	11	74669459	missense	probably benign	0.10
R7317:Cluh	UTSW	11	74665704	missense	possibly damaging	0.90
R7674:Cluh	UTSW	11	74667720	missense	probably damaging	1.00
R7941:Cluh	UTSW	11	74659757	missense	probably benign	0.00
R9326:Cluh	UTSW	11	74664076	missense	probably benign	0.00
R9489:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
R9605:Cluh	UTSW	11	74667946	missense	possibly damaging	0.92
RF020:Cluh	UTSW	11	74669538	small insertion	probably benign
RF032:Cluh	UTSW	11	74669515	small insertion	probably benign
X0028:Cluh	UTSW	11	74663466	missense	probably benign	0.26
Z1177:Cluh	UTSW	11	74667754	missense	possibly damaging	0.82
Z1186:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1186:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669516	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669520	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669521	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669524	small insertion	probably benign
Z1187:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1188:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669514	frame shift	probably null
Z1189:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669519	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669529	small insertion	probably benign
Z1189:Cluh	UTSW	11	74669530	nonsense	probably null
Z1189:Cluh	UTSW	11	74669531	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669518	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1190:Cluh	UTSW	11	74669532	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669514	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669523	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669526	small insertion	probably benign
Z1191:Cluh	UTSW	11	74669530	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669517	small insertion	probably benign
Z1192:Cluh	UTSW	11	74669525	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTCTGCCTGAAGAAATGGTGTC -3'
(R):5'- CATATGAGCCTGGCAGGAAG -3'

Sequencing Primer
(F):5'- AAATGGTGTCCCAGTGCCTGAG -3'
(R):5'- CAGGAAGGGCGGGTCTG -3'

Posted On

2021-11-19