Incidental Mutation 'R9061:Dhx8'
ID 688988
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 8
Synonyms RNA helicase, Ddx8, mDEAH6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock # R9061 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 101732919-101767358 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101741580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 455 (D455V)
Ref Sequence ENSEMBL: ENSMUSP00000037251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
AlphaFold A2A4P0
Predicted Effect possibly damaging
Transcript: ENSMUST00000039152
AA Change: D455V

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: D455V

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: D402V

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik A G 2: 156,857,213 M1T probably null Het
Abca13 A G 11: 9,277,847 E630G probably benign Het
Abcf2 T A 5: 24,573,506 H218L possibly damaging Het
Abo A T 2: 26,843,383 M268K probably benign Het
Ankrd33 G T 15: 101,116,148 probably benign Het
Apc G C 18: 34,313,198 R1049T probably damaging Het
Atg16l2 T C 7: 101,292,131 K412E probably damaging Het
Cachd1 G A 4: 100,952,005 probably null Het
Ccdc152 T G 15: 3,301,161 K11Q probably damaging Het
Ccdc38 T A 10: 93,565,873 W232R probably damaging Het
Cluh C T 11: 74,660,366 P347L possibly damaging Het
Cntn3 A G 6: 102,337,327 L142P probably damaging Het
Ctnnd2 T A 15: 30,806,738 M601K probably damaging Het
D930048N14Rik G A 11: 51,654,907 D209N unknown Het
Dcaf6 A T 1: 165,336,763 N814K probably damaging Het
Fam71f1 C T 6: 29,323,903 T209I probably benign Het
Fcna A C 2: 25,624,944 L301W possibly damaging Het
Gdf9 T G 11: 53,433,442 C13G probably damaging Het
Gm13083 T G 4: 143,616,171 S283A possibly damaging Het
Gm4763 A T 7: 24,722,748 I192N possibly damaging Het
Hells T A 19: 38,945,414 N226K probably damaging Het
Hes6 A G 1: 91,412,339 S132P probably damaging Het
Ifi207 A T 1: 173,736,587 probably benign Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kirrel2 T C 7: 30,450,880 I508V probably benign Het
Klhl38 T A 15: 58,322,626 I236F probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lamc1 A T 1: 153,251,124 C425* probably null Het
Letm1 A G 5: 33,760,869 F311L probably damaging Het
Mapk8ip2 T C 15: 89,457,813 V409A possibly damaging Het
Mybpc1 C T 10: 88,555,639 C318Y probably damaging Het
Myo15 A G 11: 60,502,866 Y1141C Het
Ndufv2 T A 17: 66,083,480 D165V probably damaging Het
Nrde2 T C 12: 100,143,864 K303E probably benign Het
Nup205 T A 6: 35,219,873 probably benign Het
Olfr1474 A G 19: 13,471,159 N21S probably damaging Het
Olfr340 A G 2: 36,452,885 Q100R probably damaging Het
Olfr452 A T 6: 42,790,207 H56L probably damaging Het
Otof C T 5: 30,388,657 V451I possibly damaging Het
Pask G A 1: 93,325,469 Q399* probably null Het
Pbk T A 14: 65,811,990 F39I probably benign Het
Pdzd2 T C 15: 12,374,667 K1794R possibly damaging Het
Pibf1 T C 14: 99,186,633 probably null Het
Ppip5k2 G A 1: 97,717,462 T1089I probably damaging Het
Ppp1cb T A 5: 32,478,148 F45L possibly damaging Het
Samd4 T C 14: 47,064,271 F344S probably damaging Het
Slc2a13 C T 15: 91,350,130 M334I possibly damaging Het
Slc37a1 C T 17: 31,337,391 A363V probably damaging Het
Slc8a3 T A 12: 81,216,766 I616F probably damaging Het
Srcin1 A G 11: 97,536,380 L257P probably damaging Het
Tarbp1 A G 8: 126,447,141 F945L probably damaging Het
Thbs4 A T 13: 92,774,679 probably null Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim62 G A 4: 128,909,170 V338M probably damaging Het
Ttll9 C T 2: 152,976,193 H20Y possibly damaging Het
Uevld A T 7: 46,938,058 I298N probably damaging Het
Zan T C 5: 137,464,391 E842G probably damaging Het
Zdbf2 T G 1: 63,307,137 S1558R Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2206:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 splice site probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
R7604:Dhx8 UTSW 11 101764797 missense probably damaging 1.00
R8135:Dhx8 UTSW 11 101738264 missense unknown
R8137:Dhx8 UTSW 11 101763982 missense probably damaging 1.00
R8256:Dhx8 UTSW 11 101740762 missense possibly damaging 0.93
R8284:Dhx8 UTSW 11 101757629 missense probably damaging 1.00
R8289:Dhx8 UTSW 11 101740745 missense probably benign 0.01
R8696:Dhx8 UTSW 11 101733132 missense unknown
R9076:Dhx8 UTSW 11 101738195 missense
R9443:Dhx8 UTSW 11 101764914 missense probably damaging 1.00
R9492:Dhx8 UTSW 11 101763982 missense possibly damaging 0.67
R9554:Dhx8 UTSW 11 101754788 nonsense probably null
R9700:Dhx8 UTSW 11 101733189 critical splice donor site probably null
R9780:Dhx8 UTSW 11 101741577 missense possibly damaging 0.73
Z1177:Dhx8 UTSW 11 101757660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACATGTGCCTTACTCTGAC -3'
(R):5'- GGTGGCTGATCTGTCTAAACAC -3'

Sequencing Primer
(F):5'- ACTCTGACTCTGATGTGCTGGC -3'
(R):5'- ACGCGCTTCTATCCAGAGATGAG -3'
Posted On 2021-11-19