Mutagenetix > Incidental Mutation

Incidental Mutation 'R9061:Dhx8'

688988

Institutional Source

Beutler Lab

Gene Symbol

Dhx8

Ensembl Gene

ENSMUSG00000034931

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 8

Synonyms

RNA helicase, Ddx8, mDEAH6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R9061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101732919-101767358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101741580 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 455 (D455V)

Ref Sequence

ENSEMBL: ENSMUSP00000037251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]

AlphaFold

A2A4P0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039152
AA Change: D455V

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: D455V

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	168	240	N/A	INTRINSIC
low complexity region	244	254	N/A	INTRINSIC
S1	287	360	3.52e-18	SMART
low complexity region	453	469	N/A	INTRINSIC
coiled coil region	496	525	N/A	INTRINSIC
DEXDc	587	771	7.26e-33	SMART
HELICc	815	919	7.45e-21	SMART
HA2	980	1070	1.34e-38	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: D402V

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	115	187	N/A	INTRINSIC
low complexity region	191	201	N/A	INTRINSIC
S1	234	307	3.52e-18	SMART
low complexity region	400	416	N/A	INTRINSIC
coiled coil region	443	472	N/A	INTRINSIC
DEXDc	534	718	7.26e-33	SMART
HELICc	762	866	7.45e-21	SMART
HA2	927	1017	1.34e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930518I15Rik	A	G	2: 156,857,213	M1T	probably null	Het
Abca13	A	G	11: 9,277,847	E630G	probably benign	Het
Abcf2	T	A	5: 24,573,506	H218L	possibly damaging	Het
Abo	A	T	2: 26,843,383	M268K	probably benign	Het
Ankrd33	G	T	15: 101,116,148		probably benign	Het
Apc	G	C	18: 34,313,198	R1049T	probably damaging	Het
Atg16l2	T	C	7: 101,292,131	K412E	probably damaging	Het
Cachd1	G	A	4: 100,952,005		probably null	Het
Ccdc152	T	G	15: 3,301,161	K11Q	probably damaging	Het
Ccdc38	T	A	10: 93,565,873	W232R	probably damaging	Het
Cluh	C	T	11: 74,660,366	P347L	possibly damaging	Het
Cntn3	A	G	6: 102,337,327	L142P	probably damaging	Het
Ctnnd2	T	A	15: 30,806,738	M601K	probably damaging	Het
D930048N14Rik	G	A	11: 51,654,907	D209N	unknown	Het
Dcaf6	A	T	1: 165,336,763	N814K	probably damaging	Het
Fam71f1	C	T	6: 29,323,903	T209I	probably benign	Het
Fcna	A	C	2: 25,624,944	L301W	possibly damaging	Het
Gdf9	T	G	11: 53,433,442	C13G	probably damaging	Het
Gm13083	T	G	4: 143,616,171	S283A	possibly damaging	Het
Gm4763	A	T	7: 24,722,748	I192N	possibly damaging	Het
Hells	T	A	19: 38,945,414	N226K	probably damaging	Het
Hes6	A	G	1: 91,412,339	S132P	probably damaging	Het
Ifi207	A	T	1: 173,736,587		probably benign	Het
Ighv16-1	A	T	12: 114,068,884	Y99*	probably null	Het
Kirrel2	T	C	7: 30,450,880	I508V	probably benign	Het
Klhl38	T	A	15: 58,322,626	I236F	probably damaging	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Lamc1	A	T	1: 153,251,124	C425*	probably null	Het
Letm1	A	G	5: 33,760,869	F311L	probably damaging	Het
Mapk8ip2	T	C	15: 89,457,813	V409A	possibly damaging	Het
Mybpc1	C	T	10: 88,555,639	C318Y	probably damaging	Het
Myo15	A	G	11: 60,502,866	Y1141C		Het
Ndufv2	T	A	17: 66,083,480	D165V	probably damaging	Het
Nrde2	T	C	12: 100,143,864	K303E	probably benign	Het
Nup205	T	A	6: 35,219,873		probably benign	Het
Olfr1474	A	G	19: 13,471,159	N21S	probably damaging	Het
Olfr340	A	G	2: 36,452,885	Q100R	probably damaging	Het
Olfr452	A	T	6: 42,790,207	H56L	probably damaging	Het
Otof	C	T	5: 30,388,657	V451I	possibly damaging	Het
Pask	G	A	1: 93,325,469	Q399*	probably null	Het
Pbk	T	A	14: 65,811,990	F39I	probably benign	Het
Pdzd2	T	C	15: 12,374,667	K1794R	possibly damaging	Het
Pibf1	T	C	14: 99,186,633		probably null	Het
Ppip5k2	G	A	1: 97,717,462	T1089I	probably damaging	Het
Ppp1cb	T	A	5: 32,478,148	F45L	possibly damaging	Het
Samd4	T	C	14: 47,064,271	F344S	probably damaging	Het
Slc2a13	C	T	15: 91,350,130	M334I	possibly damaging	Het
Slc37a1	C	T	17: 31,337,391	A363V	probably damaging	Het
Slc8a3	T	A	12: 81,216,766	I616F	probably damaging	Het
Srcin1	A	G	11: 97,536,380	L257P	probably damaging	Het
Tarbp1	A	G	8: 126,447,141	F945L	probably damaging	Het
Thbs4	A	T	13: 92,774,679		probably null	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Trim62	G	A	4: 128,909,170	V338M	probably damaging	Het
Ttll9	C	T	2: 152,976,193	H20Y	possibly damaging	Het
Uevld	A	T	7: 46,938,058	I298N	probably damaging	Het
Zan	T	C	5: 137,464,391	E842G	probably damaging	Het
Zdbf2	T	G	1: 63,307,137	S1558R		Het

Other mutations in Dhx8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01922:Dhx8	APN	11	101739807	missense	probably damaging	0.99
IGL01957:Dhx8	APN	11	101754826	missense	possibly damaging	0.48
IGL02039:Dhx8	APN	11	101764027	critical splice donor site	probably null
IGL02115:Dhx8	APN	11	101752388	missense	probably damaging	1.00
IGL02161:Dhx8	APN	11	101757606	missense	probably damaging	1.00
IGL02691:Dhx8	APN	11	101752004	splice site	probably benign
IGL02697:Dhx8	APN	11	101754781	missense	probably damaging	1.00
FR4304:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4342:Dhx8	UTSW	11	101738206	frame shift	probably null
FR4449:Dhx8	UTSW	11	101738184	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738190	small deletion	probably benign
FR4449:Dhx8	UTSW	11	101738194	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738206	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738207	small insertion	probably benign
FR4589:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738179	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738182	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738189	small insertion	probably benign
R0402:Dhx8	UTSW	11	101752397	missense	probably damaging	1.00
R0525:Dhx8	UTSW	11	101763928	missense	probably damaging	1.00
R0969:Dhx8	UTSW	11	101739700	splice site	probably benign
R1497:Dhx8	UTSW	11	101735387	intron	probably benign
R1576:Dhx8	UTSW	11	101752319	missense	probably damaging	1.00
R1758:Dhx8	UTSW	11	101766738	missense	probably damaging	1.00
R1773:Dhx8	UTSW	11	101752363	missense	possibly damaging	0.87
R1941:Dhx8	UTSW	11	101752198	critical splice donor site	probably null
R1954:Dhx8	UTSW	11	101753279	missense	probably damaging	0.98
R2124:Dhx8	UTSW	11	101762245	missense	probably damaging	0.99
R2128:Dhx8	UTSW	11	101738409	missense	probably benign	0.06
R2148:Dhx8	UTSW	11	101738377	nonsense	probably null
R2206:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R2207:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R4667:Dhx8	UTSW	11	101738161	missense	unknown
R4678:Dhx8	UTSW	11	101739808	missense	probably damaging	1.00
R4825:Dhx8	UTSW	11	101738170	nonsense	probably null
R4943:Dhx8	UTSW	11	101737700	nonsense	probably null
R5341:Dhx8	UTSW	11	101738190	small deletion	probably benign
R5586:Dhx8	UTSW	11	101733036	unclassified	probably benign
R5662:Dhx8	UTSW	11	101766758	missense	possibly damaging	0.89
R5664:Dhx8	UTSW	11	101740751	missense	probably damaging	1.00
R6082:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6085:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6415:Dhx8	UTSW	11	101737687	missense	unknown
R6658:Dhx8	UTSW	11	101764922	missense	probably damaging	1.00
R6841:Dhx8	UTSW	11	101764792	missense	probably damaging	0.98
R6918:Dhx8	UTSW	11	101738421	nonsense	probably null
R7011:Dhx8	UTSW	11	101741520	missense	probably damaging	1.00
R7098:Dhx8	UTSW	11	101737768	critical splice donor site	probably null
R7153:Dhx8	UTSW	11	101740175	splice site	probably null
R7284:Dhx8	UTSW	11	101754822	missense	probably damaging	1.00
R7604:Dhx8	UTSW	11	101764797	missense	probably damaging	1.00
R8135:Dhx8	UTSW	11	101738264	missense	unknown
R8137:Dhx8	UTSW	11	101763982	missense	probably damaging	1.00
R8256:Dhx8	UTSW	11	101740762	missense	possibly damaging	0.93
R8284:Dhx8	UTSW	11	101757629	missense	probably damaging	1.00
R8289:Dhx8	UTSW	11	101740745	missense	probably benign	0.01
R8696:Dhx8	UTSW	11	101733132	missense	unknown
R9076:Dhx8	UTSW	11	101738195	missense
R9443:Dhx8	UTSW	11	101764914	missense	probably damaging	1.00
R9492:Dhx8	UTSW	11	101763982	missense	possibly damaging	0.67
R9554:Dhx8	UTSW	11	101754788	nonsense	probably null
R9700:Dhx8	UTSW	11	101733189	critical splice donor site	probably null
R9780:Dhx8	UTSW	11	101741577	missense	possibly damaging	0.73
Z1177:Dhx8	UTSW	11	101757660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACATGTGCCTTACTCTGAC -3'
(R):5'- GGTGGCTGATCTGTCTAAACAC -3'

Sequencing Primer
(F):5'- ACTCTGACTCTGATGTGCTGGC -3'
(R):5'- ACGCGCTTCTATCCAGAGATGAG -3'

Posted On

2021-11-19