Incidental Mutation 'R9062:Mios'
ID 689031
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Name meiosis regulator for oocyte development
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R9062 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 8209222-8236274 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8233221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 790 (I790F)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
AlphaFold Q8VE19
Predicted Effect probably benign
Transcript: ENSMUST00000040017
AA Change: I790F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: I790F

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,291,111 W2022R probably benign Het
Ambra1 A G 2: 91,910,317 E1047G possibly damaging Het
Ankfn1 T G 11: 89,434,757 I530L probably benign Het
Apob A T 12: 8,008,046 Y2176F possibly damaging Het
Atp5a1 C T 18: 77,778,759 R171* probably null Het
Atxn10 T C 15: 85,391,717 V325A probably benign Het
B3galt1 T C 2: 68,118,546 Y202H Het
Calhm1 A T 19: 47,141,389 D231E possibly damaging Het
Cel C A 2: 28,561,202 V48F probably benign Het
Cep78 T A 19: 15,978,954 Y207F probably benign Het
Cnst T C 1: 179,606,535 probably null Het
Cpeb2 C A 5: 43,233,828 N122K Het
Cyth1 T C 11: 118,132,316 Q432R unknown Het
Eif2ak1 T C 5: 143,817,793 probably benign Het
Eif6 T C 2: 155,824,008 T76A probably benign Het
Etfrf1 A T 6: 145,215,427 N41I probably damaging Het
Etl4 T G 2: 20,743,805 L318R probably damaging Het
Fam151a G T 4: 106,748,109 W556L probably benign Het
Gas2l1 A G 11: 5,061,497 V444A probably benign Het
Gbp8 A G 5: 105,031,258 I125T possibly damaging Het
Jrkl A G 9: 13,245,333 F108L probably benign Het
Kif13a G T 13: 46,788,060 D980E possibly damaging Het
Leng9 C T 7: 4,148,667 A337T probably damaging Het
Lipo1 A C 19: 33,780,314 C252G probably damaging Het
Lrp4 C A 2: 91,473,580 D113E possibly damaging Het
Mapk8ip1 T C 2: 92,387,182 Y265C probably damaging Het
Mlf2 G A 6: 124,934,371 silent Het
Mycbp2 T A 14: 103,242,360 Y1226F probably benign Het
Ncoa6 T A 2: 155,421,428 Q362L probably benign Het
Notch3 T C 17: 32,122,718 D2020G possibly damaging Het
Olfr1216 T A 2: 89,013,204 T287S probably damaging Het
Olfr1246 T C 2: 89,590,579 M179V probably benign Het
Olfr67 T A 7: 103,787,948 I110L probably benign Het
Olfr933 A T 9: 38,976,125 I150F probably benign Het
Otop2 C A 11: 115,323,639 A74E probably benign Het
Pgm2 T C 4: 99,986,757 I579T probably damaging Het
Preb A G 5: 30,958,852 V137A probably benign Het
Psap G T 10: 60,295,958 V244L possibly damaging Het
Setbp1 A G 18: 78,857,051 S1134P probably benign Het
Skp2 G T 15: 9,113,733 P399Q probably damaging Het
Slc47a1 T G 11: 61,363,098 I222L probably benign Het
Spef2 A G 15: 9,601,631 L1515S unknown Het
Sri T C 5: 8,056,625 Y13H unknown Het
Tcf25 T C 8: 123,389,709 F248L Het
Tdrd12 T C 7: 35,480,269 T885A unknown Het
Ttn T C 2: 76,770,600 T18813A probably damaging Het
Usp42 A G 5: 143,717,985 V441A possibly damaging Het
Vwa1 A T 4: 155,770,363 S405T probably benign Het
Zbbx A T 3: 75,081,817 H326Q possibly damaging Het
Zfp64 T C 2: 168,925,827 T622A probably benign Het
Zfp677 T G 17: 21,392,553 probably null Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1802:Mios UTSW 6 8216385 nonsense probably null
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R5714:Mios UTSW 6 8215434 missense probably damaging 0.99
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6111:Mios UTSW 6 8214836 missense probably benign 0.01
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
R7381:Mios UTSW 6 8216064 missense probably damaging 0.98
R8350:Mios UTSW 6 8227998 missense probably benign 0.00
R8708:Mios UTSW 6 8234255 missense probably benign 0.17
R8913:Mios UTSW 6 8215924 missense probably benign
R9359:Mios UTSW 6 8214894 missense probably benign 0.17
R9521:Mios UTSW 6 8233171 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CCTGAGACCTAGTCAGATGGATTAC -3'
(R):5'- TGAAATACCAGTAGGAGCCATG -3'

Sequencing Primer
(F):5'- GACCTAGTCAGATGGATTACTTTGC -3'
(R):5'- TCAACTTTAAGTTAGCATCTGTGAG -3'
Posted On 2021-11-19