Incidental Mutation 'R9062:Calhm1'
ID689058
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R9062 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47141389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000107444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
AlphaFold D3Z291
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111813
AA Change: D231E

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258
AA Change: D231E

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,291,111 W2022R probably benign Het
Ambra1 A G 2: 91,910,317 E1047G possibly damaging Het
Ankfn1 T G 11: 89,434,757 I530L probably benign Het
Apob A T 12: 8,008,046 Y2176F possibly damaging Het
Atp5a1 C T 18: 77,778,759 R171* probably null Het
Atxn10 T C 15: 85,391,717 V325A probably benign Het
B3galt1 T C 2: 68,118,546 Y202H Het
Cel C A 2: 28,561,202 V48F probably benign Het
Cep78 T A 19: 15,978,954 Y207F probably benign Het
Cnst T C 1: 179,606,535 probably null Het
Cpeb2 C A 5: 43,233,828 N122K Het
Cyth1 T C 11: 118,132,316 Q432R unknown Het
Eif2ak1 T C 5: 143,817,793 probably benign Het
Eif6 T C 2: 155,824,008 T76A probably benign Het
Etfrf1 A T 6: 145,215,427 N41I probably damaging Het
Etl4 T G 2: 20,743,805 L318R probably damaging Het
Fam151a G T 4: 106,748,109 W556L probably benign Het
Gas2l1 A G 11: 5,061,497 V444A probably benign Het
Gbp8 A G 5: 105,031,258 I125T possibly damaging Het
Jrkl A G 9: 13,245,333 F108L probably benign Het
Kif13a G T 13: 46,788,060 D980E possibly damaging Het
Leng9 C T 7: 4,148,667 A337T probably damaging Het
Lipo1 A C 19: 33,780,314 C252G probably damaging Het
Lrp4 C A 2: 91,473,580 D113E possibly damaging Het
Mapk8ip1 T C 2: 92,387,182 Y265C probably damaging Het
Mios A T 6: 8,233,221 I790F probably benign Het
Mycbp2 T A 14: 103,242,360 Y1226F probably benign Het
Ncoa6 T A 2: 155,421,428 Q362L probably benign Het
Notch3 T C 17: 32,122,718 D2020G possibly damaging Het
Olfr1216 T A 2: 89,013,204 T287S probably damaging Het
Olfr1246 T C 2: 89,590,579 M179V probably benign Het
Olfr67 T A 7: 103,787,948 I110L probably benign Het
Olfr933 A T 9: 38,976,125 I150F probably benign Het
Otop2 C A 11: 115,323,639 A74E probably benign Het
Pgm2 T C 4: 99,986,757 I579T probably damaging Het
Preb A G 5: 30,958,852 V137A probably benign Het
Psap G T 10: 60,295,958 V244L possibly damaging Het
Setbp1 A G 18: 78,857,051 S1134P probably benign Het
Skp2 G T 15: 9,113,733 P399Q probably damaging Het
Slc47a1 T G 11: 61,363,098 I222L probably benign Het
Spef2 A G 15: 9,601,631 L1515S unknown Het
Sri T C 5: 8,056,625 Y13H unknown Het
Tcf25 T C 8: 123,389,709 F248L Het
Tdrd12 T C 7: 35,480,269 T885A unknown Het
Ttn T C 2: 76,770,600 T18813A probably damaging Het
Usp42 A G 5: 143,717,985 V441A possibly damaging Het
Vwa1 A T 4: 155,770,363 S405T probably benign Het
Zbbx A T 3: 75,081,817 H326Q possibly damaging Het
Zfp64 T C 2: 168,925,827 T622A probably benign Het
Zfp677 T G 17: 21,392,553 probably null Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF032:Calhm1 UTSW 19 47141283 frame shift probably null
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTATTCATGGTGCCTTGG -3'
(R):5'- GGACAGGTAGATCTGCTGAC -3'

Sequencing Primer
(F):5'- GTGATGCCACGCAACTTC -3'
(R):5'- AGGTAGATCTGCTGACGTCCTTC -3'
Posted On2021-11-19