Incidental Mutation 'R9063:Nck2'
ID 689059
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Name non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms 4833426I10Rik, Grb4, NCKbeta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9063 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 43444579-43570515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43554343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 237 (C237R)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000202540]
AlphaFold O55033
Predicted Effect possibly damaging
Transcript: ENSMUST00000086421
AA Change: C237R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: C237R

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114744
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202540
SMART Domains Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877

DomainStartEndE-ValueType
SH3 5 60 4.3e-19 SMART
PDB:2CUB|A 106 142 4e-13 PDB
Blast:SH3 114 142 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T G 7: 116,104,425 S178A probably benign Het
Add3 T C 19: 53,233,871 L303P probably damaging Het
Agr2 T A 12: 36,003,899 *176K probably null Het
Apobr C T 7: 126,586,748 T477I probably benign Het
Cdca7l G A 12: 117,874,801 V336M probably damaging Het
Cep63 T G 9: 102,619,028 H18P unknown Het
Copa A G 1: 172,116,962 D838G probably benign Het
Cspg4 G T 9: 56,888,403 V1141L probably benign Het
D930020B18Rik A G 10: 121,661,097 T146A probably benign Het
Dapk1 A T 13: 60,718,450 I206L probably benign Het
Emsy C T 7: 98,646,477 D73N probably damaging Het
Esr2 A T 12: 76,121,816 Y540N probably benign Het
Exoc7 C A 11: 116,289,275 V668L probably benign Het
Fcgbp C T 7: 28,091,852 T846I probably damaging Het
Fhod3 A G 18: 25,020,715 E418G probably damaging Het
Fryl G A 5: 73,081,003 R1467C possibly damaging Het
Gas2l3 A G 10: 89,413,696 I520T probably benign Het
Gfod1 A G 13: 43,200,804 C232R probably benign Het
Gpr61 T C 3: 108,150,239 R369G probably benign Het
Hk1 T C 10: 62,286,650 Y423C probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Jmy T C 13: 93,499,072 R79G probably benign Het
Kcnn4 T A 7: 24,377,509 V161E probably damaging Het
Kif15 T A 9: 123,004,641 I1040N probably damaging Het
Kif2b A G 11: 91,575,828 L543S probably damaging Het
Kpna2 A G 11: 106,992,663 I81T probably benign Het
Krt12 A G 11: 99,416,931 S444P probably benign Het
Lmnb2 C T 10: 80,906,171 V29M probably benign Het
Lmod2 T C 6: 24,603,365 V113A probably benign Het
Lrp1b T C 2: 41,341,826 T1211A Het
Lrrc8d T C 5: 105,814,093 S790P probably damaging Het
Map3k4 A G 17: 12,263,991 V613A probably damaging Het
Marveld2 T C 13: 100,612,145 N142S probably benign Het
Mfsd7a A G 5: 108,442,237 L433P probably damaging Het
Mgll G A 6: 88,825,708 V282I possibly damaging Het
Mief2 G A 11: 60,731,488 E295K probably damaging Het
Mmrn2 A T 14: 34,398,610 H479L probably benign Het
Myh15 T A 16: 49,092,755 N358K probably benign Het
Mzf1 T G 7: 13,053,078 K101Q probably damaging Het
Ncbp3 T A 11: 73,073,427 L401Q probably damaging Het
Nlrp9a T G 7: 26,573,866 N976K possibly damaging Het
Nol11 A G 11: 107,173,414 V524A probably benign Het
Nol11 T C 11: 107,179,031 Y331C possibly damaging Het
Nsmf A T 2: 25,062,610 H149L probably benign Het
Olfm3 T C 3: 115,120,933 V231A probably benign Het
Olfr364-ps1 A T 2: 37,146,634 M141L probably benign Het
Olfr544 T C 7: 102,484,724 Y132C probably damaging Het
Olfr575 A G 7: 102,955,239 S121P probably benign Het
Pcdhgb5 T A 18: 37,731,686 F178Y probably damaging Het
Plk2 T A 13: 110,396,386 S160R possibly damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1cc A G 5: 122,168,216 N33D probably benign Het
Ptpn23 T C 9: 110,389,625 E499G possibly damaging Het
Pwp1 A G 10: 85,884,567 H356R probably benign Het
Rbsn G T 6: 92,194,019 T307K probably benign Het
Rnf19a G A 15: 36,265,469 Q161* probably null Het
Scin T C 12: 40,084,337 D236G possibly damaging Het
Setd1a G A 7: 127,786,386 R755H possibly damaging Het
Sik3 C T 9: 46,212,437 T1178I probably benign Het
Tex26 C T 5: 149,470,361 R272C probably damaging Het
Trim60 T A 8: 65,000,813 K261N possibly damaging Het
Tspan9 A G 6: 127,967,109 I76T probably damaging Het
Ttn T A 2: 76,758,489 Y21412F probably damaging Het
Ttn A T 2: 76,880,563 I8409N unknown Het
Unc80 T C 1: 66,606,657 probably null Het
Ush2a A T 1: 188,263,260 Q76L probably benign Het
Usp1 G A 4: 98,931,152 V284I probably benign Het
Usp31 A G 7: 121,707,243 V4A probably benign Het
Vmn2r88 G A 14: 51,410,872 probably benign Het
Zfp959 G A 17: 55,897,221 R86K probably benign Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
wake UTSW 1 43554260 missense probably benign
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R1080:Nck2 UTSW 1 43533581 missense probably benign 0.00
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4029:Nck2 UTSW 1 43554091 missense probably benign
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6683:Nck2 UTSW 1 43569178 missense probably benign
R6859:Nck2 UTSW 1 43554351 missense probably benign 0.24
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
R8278:Nck2 UTSW 1 43554580 missense probably damaging 1.00
R9004:Nck2 UTSW 1 43554350 missense
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACGTTTTGGAGGAAGCGGAC -3'
(R):5'- ACTCGCTGTCCCTAATGAGG -3'

Sequencing Primer
(F):5'- GCCCCCAGCTTCCTGAG -3'
(R):5'- TCATTGAGCGCACACTCG -3'
Posted On 2021-11-19