Incidental Mutation 'R9063:Lmnb2'
ID 689099
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9063 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80906171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 29 (V29M)
Ref Sequence ENSEMBL: ENSMUSP00000100969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000179022]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000057623
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
AA Change: V29M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: V29M

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179022
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T G 7: 116,104,425 S178A probably benign Het
Add3 T C 19: 53,233,871 L303P probably damaging Het
Agr2 T A 12: 36,003,899 *176K probably null Het
Apobr C T 7: 126,586,748 T477I probably benign Het
Cdca7l G A 12: 117,874,801 V336M probably damaging Het
Cep63 T G 9: 102,619,028 H18P unknown Het
Copa A G 1: 172,116,962 D838G probably benign Het
Cspg4 G T 9: 56,888,403 V1141L probably benign Het
D930020B18Rik A G 10: 121,661,097 T146A probably benign Het
Dapk1 A T 13: 60,718,450 I206L probably benign Het
Emsy C T 7: 98,646,477 D73N probably damaging Het
Esr2 A T 12: 76,121,816 Y540N probably benign Het
Exoc7 C A 11: 116,289,275 V668L probably benign Het
Fcgbp C T 7: 28,091,852 T846I probably damaging Het
Fhod3 A G 18: 25,020,715 E418G probably damaging Het
Fryl G A 5: 73,081,003 R1467C possibly damaging Het
Gas2l3 A G 10: 89,413,696 I520T probably benign Het
Gfod1 A G 13: 43,200,804 C232R probably benign Het
Gpr61 T C 3: 108,150,239 R369G probably benign Het
Hk1 T C 10: 62,286,650 Y423C probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Jmy T C 13: 93,499,072 R79G probably benign Het
Kcnn4 T A 7: 24,377,509 V161E probably damaging Het
Kif15 T A 9: 123,004,641 I1040N probably damaging Het
Kif2b A G 11: 91,575,828 L543S probably damaging Het
Kpna2 A G 11: 106,992,663 I81T probably benign Het
Krt12 A G 11: 99,416,931 S444P probably benign Het
Lmod2 T C 6: 24,603,365 V113A probably benign Het
Lrp1b T C 2: 41,341,826 T1211A Het
Lrrc8d T C 5: 105,814,093 S790P probably damaging Het
Map3k4 A G 17: 12,263,991 V613A probably damaging Het
Marveld2 T C 13: 100,612,145 N142S probably benign Het
Mfsd7a A G 5: 108,442,237 L433P probably damaging Het
Mgll G A 6: 88,825,708 V282I possibly damaging Het
Mief2 G A 11: 60,731,488 E295K probably damaging Het
Mmrn2 A T 14: 34,398,610 H479L probably benign Het
Myh15 T A 16: 49,092,755 N358K probably benign Het
Mzf1 T G 7: 13,053,078 K101Q probably damaging Het
Ncbp3 T A 11: 73,073,427 L401Q probably damaging Het
Nck2 T C 1: 43,554,343 C237R possibly damaging Het
Nlrp9a T G 7: 26,573,866 N976K possibly damaging Het
Nol11 A G 11: 107,173,414 V524A probably benign Het
Nol11 T C 11: 107,179,031 Y331C possibly damaging Het
Nsmf A T 2: 25,062,610 H149L probably benign Het
Olfm3 T C 3: 115,120,933 V231A probably benign Het
Olfr364-ps1 A T 2: 37,146,634 M141L probably benign Het
Olfr544 T C 7: 102,484,724 Y132C probably damaging Het
Olfr575 A G 7: 102,955,239 S121P probably benign Het
Pcdhgb5 T A 18: 37,731,686 F178Y probably damaging Het
Plk2 T A 13: 110,396,386 S160R possibly damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1cc A G 5: 122,168,216 N33D probably benign Het
Ptpn23 T C 9: 110,389,625 E499G possibly damaging Het
Pwp1 A G 10: 85,884,567 H356R probably benign Het
Rbsn G T 6: 92,194,019 T307K probably benign Het
Rnf19a G A 15: 36,265,469 Q161* probably null Het
Scin T C 12: 40,084,337 D236G possibly damaging Het
Setd1a G A 7: 127,786,386 R755H possibly damaging Het
Sik3 C T 9: 46,212,437 T1178I probably benign Het
Tex26 C T 5: 149,470,361 R272C probably damaging Het
Trim60 T A 8: 65,000,813 K261N possibly damaging Het
Tspan9 A G 6: 127,967,109 I76T probably damaging Het
Ttn T A 2: 76,758,489 Y21412F probably damaging Het
Ttn A T 2: 76,880,563 I8409N unknown Het
Unc80 T C 1: 66,606,657 probably null Het
Ush2a A T 1: 188,263,260 Q76L probably benign Het
Usp1 G A 4: 98,931,152 V284I probably benign Het
Usp31 A G 7: 121,707,243 V4A probably benign Het
Vmn2r88 G A 14: 51,410,872 probably benign Het
Zfp959 G A 17: 55,897,221 R86K probably benign Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80905148 missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80905079 critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATAGACTCTAGCCCAGGGATC -3'
(R):5'- CCAATAGAGCTTCAGTGTAGAGC -3'

Sequencing Primer
(F):5'- ACTCTAGCCCAGGGATCTAGGG -3'
(R):5'- AGCTTCAGTGTAGAGCCCTGTG -3'
Posted On 2021-11-19